In [1]:
import pandas as pd
In [2]:
df = pd.read_csv('patents.csv', encoding='latin1')
In [3]:
df.head()
Out[3]:
Publication Number Title Priority Number Priority Date Application Number Application Date Publication Kind Code Publication Date Inventor - w/address Assignee/Applicant ... US Class - Original Cited Refs - Patent Count of Cited Refs - Patent Cited Refs - Non-patent Count of Cited Refs - Non-patent Citing Patents Count of Citing Patents INPADOC Legal Status INPADOC Family Members INPADOC Family ID
0 US8919357B2 Steam appliance US2009567718A 2009-09-25 US13653717A 2012-10-17 B2 2014-12-30 Breit Oliver Rudolph|Mid Levels, HK Euro-Pro Operating LLC,Newton,MA,US ... 134105 CN2544162Y | US7516565B1 | CN2741495Y | US5609... 36 Evaluation Report for Chinese Application No. ... 6 US20160128536A1 | US20160128537A1 | US9549651B... 5 2022-06-30 MAFP MAINTENANCE FEE PAYMENT + PAYM... US8919357B2 | CN102029266A | CN102029266B | CN... 20100624JP03160354U_
1 US8920125B2 Dual frequency hub mounted vibration suppresso... US200870097P | US2009353217A 2008-03-20 | 2009-01-13 US13774011A 2013-02-22 B2 2014-12-30 Welsh William A.|North Haven, CT, US Sikorsky Aircraft Corporation,Stratford,CT,US ... 416145 | 0745741 | 310081 US4326158A | US5310137A | US5757662A | US69078... 34 Kayler, Kimberly. “LORD Corporation's Technolo... 3 US10167079B2 | US10308355B2 | US10400851B2 | U... 23 2022-06-30 MAFP MAINTENANCE FEE PAYMENT + PAYM... US8920125B2 | US20090236468A1 | US20130164132A... 20090924US20090236468A1
2 US8920781B2 Carrier particles for use in dry powder inhalers GB19951841A | GB199521937A | WO1996GB215A | US... 1995-01-31 | 1995-10-26 | 1996-01-31 | 1997-09... US2010748275A 2010-03-26 B2 2014-12-30 Staniforth John Nicholas|Bath, GB Vectura Limited,Chippenham, Wiltshire,GB | Sta... ... 424046 | 424489 | 424490 | 424493 | 424499 | 5... US6521260B1 | US7744855B2 | WO1995000127A1 | Z... 54 Ahmed “Particle Interactions in Multicomponent... 13 US10561613B2 | US20160243039A1 | WO2022047047A1 3 2019-02-26 FP LAPSED DUE TO FAILURE TO PAY MAI... US8920781B2 | AT256450T | AT355822T | AT526946... 19950322GB199501841D0
3 US8921104B2 Method for producing dendritic cells GB199824306A | WO1999GB3653A | US2001849499A |... 1998-11-05 | 1999-11-05 | 2001-05-04 | 2007-04... US13538995A 2012-06-29 B2 2014-12-30 Waldmann Herman|Oxford, GB | Fairchild Paul J.... ISIS Innovation Limited,Oxford,GB | Waldmann H... ... 435325 | 435375 WO1997021802A1 | US7781213B2 | US7473556B2 | U... 6 Brossart et al. Virus-mediated delivery of ant... 22 US11020465B2 1 2023-02-28 FP LAPSED DUE TO FAILURE TO PAY MAI... US8921104B2 | AU200010584A | AU768267B2 | CA23... 19981230GB199824306D0
4 US8923511B2 Enciphering apparatus and method, deciphering ... JP1997106136A | US199859776A | US2001872509A |... 1997-04-23 | 1998-04-14 | 2001-06-01 | 2006-02... US13899054A 2013-05-21 B2 2014-12-30 Ishiguro Ryuji|Tokyo, JP | Osawa Yoshitomo|Kan... Sony Corporation,Tokyo,JP ... 380044 | 713189 US4972475A | US4203166A | US5148485A | US61050... 80 Schneier Bruce: “Applied Cryptography Second E... 18 US20150381359A1 | US9467287B2 2 2021-11-04 AS ASSIGNMENT REDWOOD TECHNOLOGIES,... US8923511B2 | CN100418317C | CN1190033C | CN12... 19981029ID20227A_

5 rows × 54 columns

In [4]:
df.tail()
Out[4]:
Publication Number Title Priority Number Priority Date Application Number Application Date Publication Kind Code Publication Date Inventor - w/address Assignee/Applicant ... US Class - Original Cited Refs - Patent Count of Cited Refs - Patent Cited Refs - Non-patent Count of Cited Refs - Non-patent Citing Patents Count of Citing Patents INPADOC Legal Status INPADOC Family Members INPADOC Family ID
2779 US8921041B2 Device and method for electroporation-based de... US2002397749P | US2002435400P | US2003469572P ... 2002-07-20 | 2002-12-20 | 2003-05-09 | 2003-11... US13474355A 2012-05-17 B2 2014-12-30 Wang Xiaobo|San Diego, CA, US | Abassi Yama A.... ACEA Biosciences Inc.,San Diego,CA,US | Wang X... ... 4350061 | 435456 | 4351731 | 4351736 | 435476 ... WO2001038873A2 | US2656508A | US3743581A | US4... 96 Wegener et al., Experimental Cell Research vol... 67 EP3556845A1 | RU2636890C2 | US10012636B2 | US1... 26 2023-02-28 FP LAPSED DUE TO FAILURE TO PAY MAI... US8921041B2 | AT442587T | AT448482T | AU200326... 20040129CA2493101A1
2780 US8923821B2 Transceiver with message notification DE10043284A | WO2001DE3304A | US2003363625A 2000-09-02 | 2001-08-30 | 2003-09-12 US2010696904A 2010-01-29 B2 2014-12-30 Hans Martin|Hildesheim, DE | Kowalewski Frank|... IPCOM GmbH & Co. KG,Pullach,DE | Hans Martin,H... ... 4554122 | 455413 | 455466 US6018232A | US20040033783A1 | US6088516A | US... 43 Nokia 9000i, “User's Manual, ” (1995-1997). | ... 4 NaN 0 2023-02-28 FP LAPSED DUE TO FAILURE TO PAY MAI... US8923821B2 | DE10043284C1 | DE20122148U1 | DE... 20020207DE10043284C1
2781 US8921100B2 Use of the adenoviral E2 late promoter DE10150984A | WO2002EP11527A | US2004492802A 2001-10-16 | 2002-10-15 | 2004-10-22 US2009498208A 2009-07-06 B2 2014-12-30 Holm Per Sonne|Fürstenfeldbruck, DE Technische Universität München,München,DE | Ho... ... 4353201 | 53602372 | 5360241 US7195896B2 | US5994132A | WO1997016547A1 3 Bhat et al., 1987, EMBO Journal, vol. 6, No. 7... 4 US10155930B2 | US10300096B2 | US10731136B2 | U... 4 2022-06-30 MAFP MAINTENANCE FEE PAYMENT + PAYM... US8921100B2 | AT500338T | AU2002350545A1 | CA2... 20030417DE10150984A1
2782 US8920474B2 Plate for osteosynthesis device and method of ... FR200113460A | WO2002IB4307A | US2004492827A 2001-10-18 | 2002-10-18 | 2004-07-15 US13454927A 2012-04-24 B2 2014-12-30 Delecrin Joël|Vertou, FR | Allain Jérôme|Paris... LDR Medical,Rosières Près Troyes,FR | Delecrin... ... 606257 | 606264 US6641583B2 | US6613053B1 | US6287309B1 3 NaN 0 US10188528B2 | US10350088B2 | US10398574B2 | U... 8 2022-06-15 MAFP MAINTENANCE FEE PAYMENT + PAYM... US8920474B2 | EP1435861A1 | EP1435861B1 | ES23... 20030424WO2003032851A1
2783 US8921321B2 Therapeutic strategies for prevention and trea... GB200117645A | US2002200023A 2001-07-19 | 2002-07-19 US13690646A 2012-11-30 B2 2014-12-30 Nagy Zsuzsanna|Birmingham, GB Isis Innovation Ltd.,Oxford,GB ... 5140178 | 514034 | 514183 | 51425217 | 514557 ... US6147094A | US6264994B1 | JP1997221421A | JP2... 35 Arendt, Th. et al., “Neuroprotection by Repres... 36 NaN 0 2019-02-26 FP LAPSED DUE TO FAILURE TO PAY MAI... US8921321B2 | AT481093T | AT524169T | AT535236... 20010912GB200117645D0

5 rows × 54 columns

In [5]:
df.shape
Out[5]:
(2784, 54)
In [6]:
df.columns
Out[6]:
Index(['Publication Number', 'Title', 'Priority Number', 'Priority Date',
       'Application Number', 'Application Date', 'Publication Kind Code',
       'Publication Date', 'Inventor - w/address', 'Assignee/Applicant',
       'Assignee - Current US', 'DWPI Class', 'DWPI Manual Codes',
       'IPC - Current', 'CPC - Current', 'US Class', 'ECLA', 'Abstract',
       'Title (Original language)', 'Claims', 'Claims Count', 'First Claim',
       'Independent Claims', 'Description',
       'Assignee/Applicant (Original Language)', 'Assignee - Original',
       'Optimized Assignee', 'Ultimate Parent', 'Inventor', 'Inventor Count',
       'Attorney/Agent', 'Correspondent', 'Examiner',
       'Publication Country Code', 'Dead/Alive', 'Publication Month',
       'Publication Year', 'Application Country/Region', 'Application Month',
       'Application Year', 'Priority Date - Earliest',
       'Earliest Priority Year', 'IPC Class', 'CPC Class',
       'US Class - Original', 'Cited Refs - Patent',
       'Count of Cited Refs - Patent', 'Cited Refs - Non-patent',
       'Count of Cited Refs - Non-patent', 'Citing Patents',
       'Count of Citing Patents', 'INPADOC Legal Status',
       'INPADOC Family Members', 'INPADOC Family ID'],
      dtype='object')
In [7]:
df.duplicated().sum()
Out[7]:
0
In [8]:
df.isnull().sum()
Out[8]:
Publication Number                           0
Title                                        0
Priority Number                              0
Priority Date                                0
Application Number                           0
Application Date                             0
Publication Kind Code                        0
Publication Date                             0
Inventor - w/address                         0
Assignee/Applicant                           0
Assignee - Current US                        0
DWPI Class                                   0
DWPI Manual Codes                          242
IPC - Current                                0
CPC - Current                                0
US Class                                     0
ECLA                                      2784
Abstract                                     0
Title (Original language)                    0
Claims                                       0
Claims Count                                 0
First Claim                                  0
Independent Claims                           0
Description                                  0
Assignee/Applicant (Original Language)       0
Assignee - Original                          0
Optimized Assignee                           0
Ultimate Parent                              0
Inventor                                     0
Inventor Count                               0
Attorney/Agent                             226
Correspondent                             2784
Examiner                                     0
Publication Country Code                     0
Dead/Alive                                   0
Publication Month                            0
Publication Year                             0
Application Country/Region                   0
Application Month                            0
Application Year                             0
Priority Date - Earliest                     0
Earliest Priority Year                       0
IPC Class                                    0
CPC Class                                    0
US Class - Original                          0
Cited Refs - Patent                          6
Count of Cited Refs - Patent                 0
Cited Refs - Non-patent                    911
Count of Cited Refs - Non-patent             0
Citing Patents                             741
Count of Citing Patents                      0
INPADOC Legal Status                         1
INPADOC Family Members                       0
INPADOC Family ID                            0
dtype: int64
In [9]:
df.info()
<class 'pandas.core.frame.DataFrame'>
RangeIndex: 2784 entries, 0 to 2783
Data columns (total 54 columns):
 #   Column                                  Non-Null Count  Dtype  
---  ------                                  --------------  -----  
 0   Publication Number                      2784 non-null   object 
 1   Title                                   2784 non-null   object 
 2   Priority Number                         2784 non-null   object 
 3   Priority Date                           2784 non-null   object 
 4   Application Number                      2784 non-null   object 
 5   Application Date                        2784 non-null   object 
 6   Publication Kind Code                   2784 non-null   object 
 7   Publication Date                        2784 non-null   object 
 8   Inventor - w/address                    2784 non-null   object 
 9   Assignee/Applicant                      2784 non-null   object 
 10  Assignee - Current US                   2784 non-null   object 
 11  DWPI Class                              2784 non-null   object 
 12  DWPI Manual Codes                       2542 non-null   object 
 13  IPC - Current                           2784 non-null   object 
 14  CPC - Current                           2784 non-null   object 
 15  US Class                                2784 non-null   object 
 16  ECLA                                    0 non-null      float64
 17  Abstract                                2784 non-null   object 
 18  Title (Original language)               2784 non-null   object 
 19  Claims                                  2784 non-null   object 
 20  Claims Count                            2784 non-null   int64  
 21  First Claim                             2784 non-null   object 
 22  Independent Claims                      2784 non-null   object 
 23  Description                             2784 non-null   object 
 24  Assignee/Applicant (Original Language)  2784 non-null   object 
 25  Assignee - Original                     2784 non-null   object 
 26  Optimized Assignee                      2784 non-null   object 
 27  Ultimate Parent                         2784 non-null   object 
 28  Inventor                                2784 non-null   object 
 29  Inventor Count                          2784 non-null   int64  
 30  Attorney/Agent                          2558 non-null   object 
 31  Correspondent                           0 non-null      float64
 32  Examiner                                2784 non-null   object 
 33  Publication Country Code                2784 non-null   object 
 34  Dead/Alive                              2784 non-null   object 
 35  Publication Month                       2784 non-null   int64  
 36  Publication Year                        2784 non-null   int64  
 37  Application Country/Region              2784 non-null   object 
 38  Application Month                       2784 non-null   int64  
 39  Application Year                        2784 non-null   int64  
 40  Priority Date - Earliest                2784 non-null   object 
 41  Earliest Priority Year                  2784 non-null   int64  
 42  IPC Class                               2784 non-null   object 
 43  CPC Class                               2784 non-null   object 
 44  US Class - Original                     2784 non-null   object 
 45  Cited Refs - Patent                     2778 non-null   object 
 46  Count of Cited Refs - Patent            2784 non-null   int64  
 47  Cited Refs - Non-patent                 1873 non-null   object 
 48  Count of Cited Refs - Non-patent        2784 non-null   int64  
 49  Citing Patents                          2043 non-null   object 
 50  Count of Citing Patents                 2784 non-null   int64  
 51  INPADOC Legal Status                    2783 non-null   object 
 52  INPADOC Family Members                  2784 non-null   object 
 53  INPADOC Family ID                       2784 non-null   object 
dtypes: float64(2), int64(10), object(42)
memory usage: 1.1+ MB
In [10]:
df.describe()
Out[10]:
ECLA Claims Count Inventor Count Correspondent Publication Month Publication Year Application Month Application Year Earliest Priority Year Count of Cited Refs - Patent Count of Cited Refs - Non-patent Count of Citing Patents
count 0.0 2784.000000 2784.000000 0.0 2784.0 2784.0 2784.000000 2784.000000 2784.000000 2784.000000 2784.000000 2784.000000
mean NaN 16.423491 2.764368 NaN 12.0 2014.0 6.552083 2011.117098 2009.255747 39.255388 9.627155 8.361710
std NaN 10.579774 1.826604 NaN 0.0 0.0 3.470550 1.723402 2.575480 100.866090 41.288156 37.604638
min NaN 1.000000 1.000000 NaN 12.0 2014.0 1.000000 2000.000000 1995.000000 0.000000 0.000000 0.000000
25% NaN 10.000000 1.000000 NaN 12.0 2014.0 3.000000 2010.000000 2008.000000 9.000000 0.000000 0.000000
50% NaN 16.000000 2.000000 NaN 12.0 2014.0 6.000000 2012.000000 2010.000000 16.000000 2.000000 2.000000
75% NaN 20.000000 4.000000 NaN 12.0 2014.0 10.000000 2012.000000 2011.000000 30.000000 5.000000 7.000000
max NaN 293.000000 15.000000 NaN 12.0 2014.0 12.000000 2014.000000 2014.000000 2197.000000 1180.000000 1050.000000
In [11]:
df = df.drop(['ECLA', 'Correspondent'], axis = 1)
In [12]:
df.fillna({'DWPI Manual Codes': 'Not available', 'Attorney/Agent': 'Not available', 'Cited Refs - Non-patent': 'Not available', 
           'Citing Patents': 'Not available', 'INPADOC Legal Status': 'Not aviailable' }, inplace=True)
In [13]:
df.isnull().sum()
Out[13]:
Publication Number                        0
Title                                     0
Priority Number                           0
Priority Date                             0
Application Number                        0
Application Date                          0
Publication Kind Code                     0
Publication Date                          0
Inventor - w/address                      0
Assignee/Applicant                        0
Assignee - Current US                     0
DWPI Class                                0
DWPI Manual Codes                         0
IPC - Current                             0
CPC - Current                             0
US Class                                  0
Abstract                                  0
Title (Original language)                 0
Claims                                    0
Claims Count                              0
First Claim                               0
Independent Claims                        0
Description                               0
Assignee/Applicant (Original Language)    0
Assignee - Original                       0
Optimized Assignee                        0
Ultimate Parent                           0
Inventor                                  0
Inventor Count                            0
Attorney/Agent                            0
Examiner                                  0
Publication Country Code                  0
Dead/Alive                                0
Publication Month                         0
Publication Year                          0
Application Country/Region                0
Application Month                         0
Application Year                          0
Priority Date - Earliest                  0
Earliest Priority Year                    0
IPC Class                                 0
CPC Class                                 0
US Class - Original                       0
Cited Refs - Patent                       6
Count of Cited Refs - Patent              0
Cited Refs - Non-patent                   0
Count of Cited Refs - Non-patent          0
Citing Patents                            0
Count of Citing Patents                   0
INPADOC Legal Status                      0
INPADOC Family Members                    0
INPADOC Family ID                         0
dtype: int64
In [14]:
df.nunique()
Out[14]:
Publication Number                        2784
Title                                     2756
Priority Number                           2784
Priority Date                             2045
Application Number                        2784
Application Date                          1205
Publication Kind Code                        2
Publication Date                             1
Inventor - w/address                      2768
Assignee/Applicant                        2704
Assignee - Current US                     1731
DWPI Class                                1484
DWPI Manual Codes                         2483
IPC - Current                             2729
CPC - Current                             2783
US Class                                  2697
Abstract                                  2784
Title (Original language)                 2756
Claims                                    2784
Claims Count                                64
First Claim                               2784
Independent Claims                        2784
Description                               2784
Assignee/Applicant (Original Language)    2704
Assignee - Original                       2672
Optimized Assignee                        1484
Ultimate Parent                           1317
Inventor                                  2766
Inventor Count                              13
Attorney/Agent                            1147
Examiner                                  2150
Publication Country Code                     1
Dead/Alive                                   2
Publication Month                            1
Publication Year                             1
Application Country/Region                   1
Application Month                           12
Application Year                            14
Priority Date - Earliest                  1467
Earliest Priority Year                      20
IPC Class                                  940
CPC Class                                 1115
US Class - Original                       2698
Cited Refs - Patent                       2778
Count of Cited Refs - Patent               242
Cited Refs - Non-patent                   1870
Count of Cited Refs - Non-patent           120
Citing Patents                            2040
Count of Citing Patents                     94
INPADOC Legal Status                      2681
INPADOC Family Members                    2784
INPADOC Family ID                         2770
dtype: int64
In [15]:
import matplotlib.pyplot as plt
import seaborn as sns
In [16]:
import numpy as np
In [17]:
import warnings
warnings.filterwarnings('ignore')
In [18]:
obj_cols = df.select_dtypes(include='object').columns.tolist()
print("Object columns:", obj_cols)
Object columns: ['Publication Number', 'Title', 'Priority Number', 'Priority Date', 'Application Number', 'Application Date', 'Publication Kind Code', 'Publication Date', 'Inventor - w/address', 'Assignee/Applicant', 'Assignee - Current US', 'DWPI Class', 'DWPI Manual Codes', 'IPC - Current', 'CPC - Current', 'US Class', 'Abstract', 'Title (Original language)', 'Claims', 'First Claim', 'Independent Claims', 'Description', 'Assignee/Applicant (Original Language)', 'Assignee - Original', 'Optimized Assignee', 'Ultimate Parent', 'Inventor', 'Attorney/Agent', 'Examiner', 'Publication Country Code', 'Dead/Alive', 'Application Country/Region', 'Priority Date - Earliest', 'IPC Class', 'CPC Class', 'US Class - Original', 'Cited Refs - Patent', 'Cited Refs - Non-patent', 'Citing Patents', 'INPADOC Legal Status', 'INPADOC Family Members', 'INPADOC Family ID']
In [19]:
num_cols = df.select_dtypes(include=['int64', 'float64']).columns.tolist()
print("Numerical columns:", num_cols)
Numerical columns: ['Claims Count', 'Inventor Count', 'Publication Month', 'Publication Year', 'Application Month', 'Application Year', 'Earliest Priority Year', 'Count of Cited Refs - Patent', 'Count of Cited Refs - Non-patent', 'Count of Citing Patents']
In [20]:
for i in obj_cols:
    print(i)
    print(df[i].unique())
    print('\n')
Publication Number
['US8919357B2' 'US8920125B2' 'US8920781B2' ... 'US8921100B2' 'US8920474B2'
 'US8921321B2']


Title
['Steam appliance'
 'Dual frequency hub mounted vibration suppressor system'
 'Carrier particles for use in dry powder inhalers' ...
 'Use of the adenoviral E2 late promoter'
 'Plate for osteosynthesis device and method of preassembling such device'
 "Therapeutic strategies for prevention and treatment of alzheimer's disease"]


Priority Number
['US2009567718A' 'US200870097P | US2009353217A'
 'GB19951841A | GB199521937A | WO1996GB215A | US1997875391A | US2000680863A | US2002306865A | US2005202741A'
 ... 'DE10150984A | WO2002EP11527A | US2004492802A'
 'FR200113460A | WO2002IB4307A | US2004492827A'
 'GB200117645A | US2002200023A']


Priority Date
['2009-09-25' '2008-03-20 | 2009-01-13'
 '1995-01-31 | 1995-10-26 | 1996-01-31 | 1997-09-25 | 2000-10-06 | 2002-11-27 | 2005-08-11'
 ... '2001-10-16 | 2002-10-15 | 2004-10-22'
 '2001-10-18 | 2002-10-18 | 2004-07-15' '2001-07-19 | 2002-07-19']


Application Number
['US13653717A' 'US13774011A' 'US2010748275A' ... 'US2009498208A'
 'US13454927A' 'US13690646A']


Application Date
['2012-10-17' '2013-02-22' '2010-03-26' ... '2010-02-08' '2010-01-29'
 '2009-07-06']


Publication Kind Code
['B2' 'B1']


Publication Date
['2014-12-30']


Inventor - w/address
['Breit Oliver Rudolph|Mid Levels, HK'
 'Welsh William A.|North Haven, CT, US'
 'Staniforth John Nicholas|Bath, GB' ...
 'Holm Per Sonne|Fürstenfeldbruck, DE'
 'Delecrin Joël|Vertou, FR | Allain Jérôme|Paris, FR | Tropiano Patrick|Marseille, FR | Ganglof Serge|Aplerin, FR | Poncer Rémi|Vannes, FR'
 'Nagy Zsuzsanna|Birmingham, GB']


Assignee/Applicant
['Euro-Pro Operating LLC,Newton,MA,US'
 'Sikorsky Aircraft Corporation,Stratford,CT,US'
 'Vectura Limited,Chippenham, Wiltshire,GB | Staniforth John Nicholas,Bath,GB'
 ...
 'Technische Universität München,München,DE | Holm Per Sonne,Fürstenfeldbruck,DE'
 'LDR Medical,Rosières Près Troyes,FR | Delecrin Joël,Vertou,FR | Allain Jérôme,Paris,FR | Tropiano Patrick,Marseille,FR | Ganglof Serge,Aplerin,FR | Poncer Rémi,Vannes,FR'
 'Isis Innovation Ltd.,Oxford,GB']


Assignee - Current US
['GLOBAL APPLIANCE INC. | SHARKNINJA OPERATING LLC | SHARKNINJA MANAGEMENT COMPANY | SHARKNINJA SALES COMPANY | EURO-PRO HOLDCO LLC | GLOBAL APPLIANCE UK HOLDCO LIMITED | COMPASS CAYMAN SPV LTD. | COMPASS CAYMAN SPV 2 LIMITED | EP MIDCO LLC'
 'SIKORSKY AIRCRAFT CORP' 'VECTURA LTD | STANIFORTH JOHN NICHOLAS' ...
 'IPCOM GMBH & CO. KG' 'TECHNISCHE UNIVERSITAET MUENCHEN' 'LDR MEDICAL']


DWPI Class
['P43 N' 'W06 E |  X11 E |  X13 E' 'B07 C |  P32 N |  P34 N' ...
 'B04 C |  D16 C |  D22 C |  S05 E |  P32 N'
 'B04 C |  D16 C |  S03 E |  T04 E |  P75 N' 'B04 C |  B05 C |  D16 C']


DWPI Manual Codes
['Not available'
 'W06-B01 | W06-B15B | X11-A01A2 | X11-A01C | X11-A10B | X11-J05X | X11-U04 | X13-F03X | X13-G | X13-U03'
 'B01-B03 | B04-B01B | B04-C01 | B04-D01 | B05-B01P | B10-B02B | B10-B03B | B12-M01B | B12-M11G | B14-D01'
 ... 'W01-C01B3E | W01-C01D3C | W01-C01G6A'
 'B04-E02 | B04-E04 | B04-E06 | B04-E08 | B14-H01 | B14-S03 | D05-H12C | D05-H12D2 | D05-H12D5 | D05-H12E'
 'B02-A | B02-C01 | B02-G | B02-R | B02-T | B04-C01G | B04-F01 | B04-J01 | B04-N04 | B05-A01B | B06-H | B07-H | B10-A18 | B10-B01B | B10-C04C | B10-C04E | B11-C08E2 | B12-K04E | B14-G02 | B14-J01A4 | B14-L06 | D05-H09']


IPC - Current
['B08B000300 | A47L001140'
 'B64C002700 | F01D000502 | F16F000710 | F16F001522 | G01M000136 | H02K000714 | H02K0041025 | H02P000552 | H02K000704 | H02K001602'
 'A61K000914 | A61K000900 | A61K000912 | A61K000916 | A61K000972 | A61K0031195 | A61K00317012 | A61P001100'
 ...
 'C12N001500 | C12N001509 | A61K00317125 | A61K003576 | A61K004800 | A61P003500 | C07H002104 | C07K0014075 | C07K001447 | C12N001511 | C12N001512 | C12N001585 | C12N001586 | C12N0015861'
 'A61B001770 | A61B001786'
 'A61P002528 | A61K003100 | A61K003119 | A61K0031395 | A61K0031436 | A61K0031439 | A61K0031496 | A61K0031517 | A61K003156 | A61K0031573 | A61K0031704 | A61K004506 | G01N003350 | G01N003368']


CPC - Current
['B08B000300 | A47L00114086 | B08B223001'
 'B64C0027001 | F01D000502 | F16F00071011 | F16F0015223 | G01M000136 | H02K000714 | H02K0041025 | H02P000556 | B64C2027003 | H02K000704 | H02K001602 | Y10T00742121 | Y10T00742127'
 'A61K00090075 | A61K000900 | A61K000912 | A61K0009145 | A61K00317012 | A61P001100 | A61P001106 | A61P001108'
 ...
 'C12N001586 | A61K004800 | A61P003500 | C07K0014075 | C07K00144702 | C12N001511 | C12N001585 | C12N271010341'
 'A61B00177007 | A61B00177001 | A61B0017701 | A61B00177011 | A61B00177037 | A61B00177041 | A61B00177082 | A61B0017864 | Y10T002949826'
 'A61K003119 | A61K0031395 | A61K0031439 | A61K0031496 | A61K0031517 | A61K003156 | A61K0031573 | A61K0031704 | A61K004506 | A61P002528 | G01N00335005 | G01N00335008 | G01N00335044 | G01N00336896 | G01N250000 | G01N250010']


US Class
['134105' '416145 | 0745741 | 310081'
 '424046 | 424489 | 424490 | 424493 | 424499 | 514951' ...
 '4353201 | 53602372 | 5360241' '606257 | 606264'
 '5140178 | 435004 | 43500724 | 435029 | 435366 | 514034 | 514183 | 51425217 | 514557']


Abstract
['A steam appliance includes a steam applicator which is connectable to the steam appliance, but the steam applicator is permitted to rotate without loosening or disengaging the connection of the steam applicator to the steam appliance. Embodiments may be particularly suitable for use with a portable, handheld steam appliance that employs steam pocket technology.'
 'A vibration suppressor system includes an annular electric motor system which independently controls rotation of at least two masses about the axis of rotation to reduce in-plane vibration of the rotating system. A method of reducing vibrations in a rotary-wing aircraft includes independently controlling a relative angular position of a multiple of independently rotatable masses to reduce vibrations of a main rotor system.'
 'A powder for use in a dry powder inhaler includes active particles and carrier particles for carrying the active particles. The powder further includes additive material on the surfaces of the carrier particles to promote the release of the active particles from the carrier particles on actuation of the inhaler. The powder is such that the active particles are not liable to be released from the carrier particles before actuation of the inhaler. The inclusion of additive material in the powder has been found to give an increased respirable fraction of the active material.'
 ...
 'The invention relates to a nucleic acid construct comprising an adenoviral E2 late promoter or a fragment thereof and a nucleic acid. The nucleic acid is selected from the group of transgenes, genes and nucleic acids which are respectively different from adenoviral nucleic acid controlled by an E2 late promoter. The invention also relates to the uses of said nucleic acid construct.'
 'Various methods, devices, and systems are disclosed that facilitate easier and more compact implantation of osteosynthesis devices. In some embodiments, implants are screwed into two vertebrae and a plate is used to hold and displace the spine. In some plate embodiments, at least one longitudinally elongated opening is disposed at one end of the plate and partially opening onto an edge of the plate. In some plate embodiments, at least one longitudinally elongated opening is disposed at one end of the plate having a portion sufficiently large to be inserted without disassembly in the fixation means of an implant already screwed into the spine when the fixation means are already assembled.'
 "The invention relates to therapeutic agents for use in the prevention or treatment of Alzheimer's disease. In particular the invention relates to use of inhibitors of cell cycle reentry and progression to the G1/S transition or inhibitors of progression of the cell cycle through the G1/S transition point in the prevention or treatment of Alzheimer's disease."]


Title (Original language)
['Steam appliance'
 'Dual frequency hub mounted vibration suppressor system'
 'Carrier particles for use in dry powder inhalers' ...
 'Use of the adenoviral E2 late promoter'
 'Plate for osteosynthesis device and method of preassembling such device'
 "Therapeutic strategies for prevention and treatment of alzheimer's disease"]


Claims
['The invention claimed is: \n1. A steam cleaning appliance, comprising: \na steam generation unit; \na steam cleaning applicator; and \na flexible steam conduit configured to guide steam from the steam generation unit to a steam inlet for the steam cleaning applicator; \nwherein the steam cleaning applicator is connectable to the steam conduit; \nthe steam cleaning applicator is rotatable relative to the steam conduit in either rotational direction without loosening the connection of the steam applicator to the steam conduit; \nthe steam cleaning applicator has an end-to-end direction and \nthe steam cleaning applicator is rotatable by at least 360 degrees relative to the steam conduit in either rotational direction about the end-to-end direction of the steam cleaning applicator, without loosening the connection of the steam cleaning applicator to the steam conduit. \n2. A steam cleaning appliance as in claim 1, wherein the steam applicator is connectable to the steam conduit via a handle.\n3. A steam cleaning appliance as in claim 2, wherein the handle has an end-to-end direction, and the handle is rotatable relative to the steam conduit about the end-to-end direction of the handle in either rotational direction without loosening the connection of the steam cleaning applicator to the steam conduit.\n4. A steam cleaning appliance as in claim 1, wherein the steam cleaning applicator is repeatedly rotatable relative to the steam conduit in either rotational direction about an end-to-end direction of the steam cleaning applicator without loosening the connection of the steam cleaning applicator to the steam conduit.\n5. A steam cleaning appliance as in claim 1, wherein the steam cleaning applicator is connectable to the steam conduit with a tool-free connection.\n6. A steam cleaning appliance as in claim 5, wherein at least two distinct user actions are required to remove the steam cleaning applicator from the steam conduit.\n7. A steam cleaning appliance as in claim 6, wherein the at least two distinct user actions comprise applying an end-to-end force on a handle relative to the steam conduit, and applying a twisting force on the handle relative to the steam conduit.\n8. A steam cleaning appliance as in claim 5, further comprising a connector that is constructed and arranged to permit rotation of the steam cleaning applicator relative to the steam conduit about an end-to-end direction of the steam applicator in either rotational direction without loosening the connection of the steam cleaning applicator to the steam conduit.\n9. A steam cleaning appliance as in claim 8, wherein the connector comprises a threaded connector having: (a) an external thread portion positioned on either the steam cleaning applicator or the steam conduit, and (b) an internal thread portion positioned on the other of the steam applicator and the steam conduit.\n10. A steam cleaning appliance as in claim 9, wherein: \nthe external thread portion is selectively rotatable relative to whichever of the steam cleaning applicator and the steam conduit that the external thread portion is positioned on, and/or the internal thread portion is selectively rotatable relative to whichever of the steam cleaning applicator and the steam conduit that the internal thread portion is positioned on. \n11. A steam cleaning appliance as in claim 10, wherein when a user applies at least a threshold force in an end-to-end direction of a handle of the steam applicator, the selectively rotatable thread portion(s) is prevented from rotating more than 180 degrees in either rotational direction relative to whichever of the steam applicator and the steam conduit that the selectively rotatable thread portion(s) is positioned on, as long as the user continues to apply the at least a threshold force.\n12. A steam cleaning appliance as in claim 11, wherein when the at least a threshold force is applied, the at least a threshold force overcomes a force provided by a resilient element.\n13. A steam cleaning appliance as in claim 12, wherein the at least a threshold force is transferred to the thread portions of the connector.\n14. A steam cleaning appliance as in claim 13, wherein the resilient element comprises a coil spring, and the at least a threshold force compresses the spring such that engagement elements on the selectively rotatable thread portion(s) engage with complementary engagement elements fixed to whichever of the steam cleaning applicator and the steam conduit that the selectively rotatable thread portion(s) is positioned on.\n15. A steam cleaning appliance as in claim 14, wherein the internal thread portion is selectively rotatable relative to whichever of the steam cleaning applicator and the steam conduit that the internal thread portion is positioned on.\n16. A steam cleaning appliance as in claim 15, wherein the internal thread portion is positioned on the handle of the steam cleaning applicator.\n17. A steam cleaning appliance as in claim 1, wherein the steam conduit comprises a flexible hose.\n18. A steam cleaning appliance as in claim 1, wherein the steam cleaning applicator includes a handle that is connected to the steam conduit.\n19. A steam cleaning appliance as in claim 2, wherein the handle is detachably connectable to the steam applicator.'
 'What is claimed is: \n1. A vibration suppressor system for reducing vibrations in a rotating system, comprising: \nan annular electric motor system provided about an axis of rotation of the rotating system, said annular electric motor system including an annular bearing and a first mass supported within said annular bearing, said first mass guided about said axis of rotation by said annular bearing, wherein said first mass is eccentric, said first mass including a truck being at least partially conductive, said annular electric motor system further including a stator axially spaced-apart, relative to said axis of rotation, from said truck; \na control system in communication with said annular electric motor system to control rotation of said first mass about said axis of rotation to reduce in-plane vibration of the rotating system; \nwherein a second mass is supported within said annular bearing, and wherein said second mass is eccentric; and \nwherein said control system independently controls rotation of said first and second masses about said axis of rotation. \n2. The system as recited in claim 1, wherein said first and second masses each include an eccentric mass positioned between said annular bearing.\n3. The system as recited in claim 1, wherein said first and second masses are configured to rotate about said axis of rotation, and wherein a majority of the mass of each of said first and second masses is radially disposed on one side of said axis of rotation.\n4. The system as recited in claim 1, wherein said first and second masses each include trucks, and wherein said trucks are eccentric.\n5. The system as recited in claim 1, further comprising: \na rotor system having an N number of blades which rotates about an axis of rotation at a rotational speed of 1P, such that said rotor system produces NP vibrations; \na sensor system which senses the NP vibrations; and \nwherein said control system is in communication with said sensor system, said control system operable to identify variations of the NP vibrations to control an angular velocity of each of said first mass and said second mass to reduce the NP in-plane rotor system vibrations. \n6. The system as recited in claim 5, further comprising a generator driven by said rotor system.\n7. The system as recited in claim 6, wherein a phase of the voltage from said generator provides a phase reference to said control system indicative of a rotational speed of said rotor system.\n8. The system as recited in claim 1, wherein said axis of rotation intersects said first mass.\n9. A vibration suppressor system for reducing vibrations in a rotating system, comprising: \nan annular electric motor system provided about an axis of rotation of the rotating system, said annular electric motor system including an annular bearing and a first mass supported within said annular bearing, said first mass guided about said axis of rotation by said annular bearing, wherein said first mass is eccentric, and wherein said axis of rotation intersects said first mass; and \na control system in communication with said annular electric motor system to control rotation of said first mass about said axis of rotation to reduce in-plane vibration of the rotating system; \nwherein a second mass is supported within said annular bearing, wherein said second mass is eccentric, and wherein said axis of rotation intersects said second mass; and \nwherein said control system independently controls rotation of said first and second masses about said axis of rotation. \n10. The system as recited in claim 9, wherein said first and second masses each include trucks, and wherein said trucks are eccentric.\n11. The system as recited in claim 10, wherein said axis of rotation intersects said trucks.\n12. A vibration suppressor system for reducing vibrations in a rotating system, comprising: \nan annular electric motor system provided about an axis of rotation of the rotating system, said annular electric motor system including an annular bearing and first and second masses supported within said annular bearing, said first and second masses guided about said axis of rotation by said annular bearing, wherein said first and second masses are eccentric, said first and second masses each including a truck which is at least partially conductive, said annular electric motor system further including at least one stator axially spaced-apart, relative to said axis of rotation, from said trucks; \na control system in communication with said annular electric motor system to control rotation of said first and second masses about said axis of rotation to reduce in-plane vibration of the rotating system; and \nwherein said first and second masses are disk-shaped and each span substantially an entirety of an inner diameter of said annular bearing.'
 'The invention claimed is: \n1. A powder for use in a dry powder inhaler, the powder comprising active particles and carrier particles for carrying the active particles, the powder further including particles of additive material attached to the surfaces of the carrier particles, wherein particles of additive material adhere to the high energy sites on the surfaces of the carrier particles and wherein the powder comprises more than one additive material, wherein the additive material includes one or more surface active materials; wherein additive particles are also present as agglomerates and act as carriers of the active particles and are separate from or separable from the surfaces of the carrier particles with active particles attached to surfaces of the agglomerates.\n2. A powder according to claim 1 wherein the powder includes not more than 5% by weight of additive material based on the weight of the powder.\n3. A powder according to claim 2 wherein the powder includes not more than 2% by weight of additive material based on the weight of the powder.\n4. A powder according to 1 wherein the carrier particles are comprised of one or more crystalline sugars.\n5. A powder according to claim 4 wherein the carrier particles are particles of lactose.\n6. A powder according to claim 1 wherein the additive material consists of physiologically acceptable material.\n7. A powder according to claim 1, wherein the additive material is an anti-adherent material.\n8. A powder according to claim 1, wherein the additive material is an anti-friction agent.\n9. A powder according to claim 1, wherein the additive material includes magnesium stearate.\n10. A powder according to claim 1, wherein the additive particles are angular or dendritic in shape.\n11. A powder according to claim 1, wherein the additive particles are plate-like particles.\n12. A powder according to claim 1, wherein the powder consists of not less than 0.1% by weight of additive particles based on the weight of the carrier particles.\n13. A powder according to claim 1, wherein the additive material forms a discontinuous covering on the surfaces of the carrier particles.\n14. A powder according to claim 1, wherein the active particles include a ?2-agonist.\n15. A method of producing particles according to claim 1, the method including the step of mixing carrier particles of a size suitable for use in dry powder inhalers with additive material which becomes attached to the surfaces of the carrier particles.\n16. A method according to claim 15 wherein the method further includes the step of treating the carrier particles to dislodge small grains from the surfaces of the carrier particles, without substantially changing the size of the carrier particles during the treatment.\n17. A method according to claim 16 wherein the small grains become reattached to the surfaces of the carrier particles.\n18. A powder for use in a dry powder inhaler, the powder including additive and carrier particles for carrying the additive particles, the powder further including active particles which adhere to the additive particles on the carrier particles, wherein the additive material is magnesium stearate, wherein the additive material is present in an amount of not more than 1% by weight based on the weight of the powder; wherein additive particles are also present as agglomerates and act as carriers of the active particles and are separate from or separable from the surfaces of the carrier particles with active particles attached to surfaces of the agglomerates.\n19. A powder according to claim 1, wherein the more than one additive material comprises magnesium stearate.\n20. A powder according to claim 1, wherein the additive particles are non-spherical.\n21. A powder according to claim 20, wherein the particles are plate-like, angular or dendritic.\n22. A powder according to claim 18, wherein the additive particles are non-spherical.\n23. A powder according to claim 22, wherein the particles are plate-like, angular or dendritic.\n24. A powder for use in a dry powder inhaler, the powder comprising: \nactive particles; \ncarrier particles for carrying the active particles; and \nparticles of additive material attached to surfaces of the carrier particles; \nwherein the particles of additive material adhere to high energy sites on the surfaces of the carrier particles and provide a discontinuous covering for the carrier particles, wherein the powder comprises more than one additive material in the form of a powder, and wherein the additive material includes one or more surface active materials; wherein additive particles are also present as agglomerates and act as carriers of the active particles and are separate from or separable from the surfaces of the carrier particles with active particles attached to surfaces of the agglomerates.'
 ...
 'The invention claimed is: \n1. An adenoviral vector suitable for use in the treatment of a tumor disease, wherein the tumor cells express YB-1 and have YB-1 in the nucleus, wherein the adenoviral vector comprises an adenoviral E2 late promoter or a fragment thereof and a nucleic acid under the control of the adenoviral E2 late promoter or the fragment thereof, wherein the nucleic acid being selected from the group consisting of adenoviral gene E1B, adenoviral gene E4orf6, and combination thereof; and wherein the adenoviral E2 late promoter or fragment thereof is regulated by YB-1.\n2. The replication-selective oncolytic adenoviral vector of claim 1, wherein the adenoviral E2 late promoter fragment comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:1 and SEQ ID NO:2.'
 'The invention claimed is: \n1. An implant for securing a spinal stabilization bar to a vertebra, the implant comprising: \na bone screw having a longitudinal screw axis and comprising a bone penetration end disposed at a first end of the longitudinal screw axis and a protrusion end disposed at a second end of the longitudinal screw axis distal from the bone penetration end; \na clamping head having a longitudinal clamping head axis and comprising a support head disposed at a first end of the longitudinal clamping head axis,  \na drive coupler disposed at a second end of the longitudinal clamping head axis and configured for engagement with a drive tool to impart rotation to the bone screw, \na stabilization bar support configured to receive a stabilization bar from the side of the implant, and \na clamp configured to secure the stabilization bar to the stabilization bar support; and \na universal joint coupling the bone screw and the clamping head. \n2. The implant of claim 1, in which the bone screw further comprises a threaded portion disposed along an external surface of the bone screw and configured for screwing into a bone.\n3. The implant of claim 1, in which the bone screw further comprises a threaded portion disposed along a hollow core that has a bone-fusion opening.\n4. The implant of claim 1, in which the stabilization bar support comprises a partially cylindrical surface complementary to a cylindrical surface of a stabilization bar.\n5. The implant of claim 1, in which universal joint is configured for transmission of a rotation of the clamping head around its longitudinal clamping head axis imparted at the drive coupler to a rotation of the bone screw around its longitudinal screw axis while an angle between the longitudinal clamping head axis and the longitudinal screw axis is non-zero, and the stabilization bar support is configured to permit said transmission while the bar is attached to the implant.\n6. The implant of claim 1, in which the drive coupler comprises a hexagonal recess and the clamp comprises a nut.\n7. The implant of claim 1, in which the stabilization bar support comprises an opening configured for rotatable disposition of the stabilization bar support about the longitudinal clamping head axis.\n8. The implant of claim 1, in which the stabilization bar support and the protrusion end have complementary surfaces configured for support of the stabilization bar support by the protrusion end.\n9. The implant of claim 8, in which the complementary surfaces are partially spherical.\n10. The implant of claim 1, in which the protrusion end comprises a housing in which the support head is disposed, and the protrusion end has a projection configured to cooperate with a concave portion of the support head to prevent rotation, relative to the bone screw, of the clamping head around its longitudinal clamping head axis.\n11. The implant of claim 1, in which the stabilization bar support is rotatable around the longitudinal clamping head axis.\n12. An implant for securing a spinal stabilization bar to a vertebra, the implant comprising: \nan elongated bone screw having a longitudinal screw axis; \na clamping head having a longitudinal clamping head axis; \na universal joint coupling the bone screw and the clamping head configured for transmission of a rotation of the clamping head around its longitudinal clamping head axis to a rotation of the bone screw around its longitudinal screw axis while an angle between the longitudinal clamping head axis and the longitudinal screw axis is non-zero; \na stabilization bar support configured to receive a stabilization bar; and \na stabilization bar support configured to permit said transmission while the bar is attached to the implant. \n13. The implant of claim 12, in which the stabilization bar support is rotatable around the longitudinal clamping head axis.\n14. The implant of claim 13, in which the bone screw further comprises a threaded portion disposed along a hollow core that has a bone-fusion opening.\n15. The implant of claim 14, in which the stabilization bar support comprises a partially cylindrical surface complementary to a cylindrical surface of a stabilization bar.\n16. The implant of claim 15, in which the stabilization bar support and an end of the bone screw have complementary surfaces configured for support of the stabilization bar support by the end of the bone screw.\n17. A system for spinal stabilization comprising: \na plurality of implants each comprising:  \nan elongated bone screw having a longitudinal screw axis, \na clamping head having a longitudinal clamping head axis, \na universal joint coupling the bone screw and the clamping head configured for transmission of a rotation of the clamping head around its longitudinal clamping head axis to a rotation of the bone screw around its longitudinal screw axis while an angle between the longitudinal clamping head axis and the longitudinal screw axis is non-zero, \na stabilization bar support configured to receive a stabilization bar and permit said transmission while the bar is attached to the implant; and \nan elongated stabilization bar having a first distal end and a second distal end, the bar comprising a pair of generally parallel rods having a space between the rods, with the space having an opening along at least one of the distal ends of the bar, and with the space being sufficient sized to allow passage of the clamping head along a path from the opening to a point between the distal ends. \n18. The system of claim 17, in which the stabilization bar support is configured to allow the rods to slide laterally across the stabilization bar support as the clamping head is passed along a path from the opening to a point between the distal ends.\n19. The system of claim 18, in which stabilization bar support is rotatable about the clamping head with the clamping head disposed between the rods of the bar.\n20. The system of claim 19, in which one of the implants has a housing in an end of the bone screw in which an end of the clamping head is disposable, and that end of the clamping head has a projection configured to cooperate with a concave portion of the housing to prevent rotation, relative to the bone screw, of the clamping head around the longitudinal clamping head axis.'
 "What is claimed is: \n1. A method of selecting a candidate compound for use in the treatment of Alzheimer's disease in a human patient, which method comprises: \n(a) incubating proliferating lymphocytes of said patient in the presence of one or more pharmaceutical agent(s), wherein said proliferating lymphocytes exhibit a cell cycle regulatory defect at the G1/S phase transition and wherein said pharmaceutical agent(s) are: \ni) inhibitors of cell cycle re-entry or progression to the G1/S transition; or \nii) inhibitors of progression of the cell cycle through the G1/S transition point; and \n(b) screening and selecting a compound that corrects said regulatory defect at the G1/S transition in said proliferating lymphocytes as a candidate compound for use in the treatment of Alzheimer's disease in said patient. \n2. The method according to claim 1, wherein said one or more pharmaceutical agent(s) include(s): \n(A) one or more inhibitors of cell cycle re-entry or progression to the G1/S transition that is an inhibitor of the G0/G1 transition, or \n(B) one or more inhibitors of progression of the cell cycle through the G1/S transition point that blocks cell cycle progression in G1, induces cell cycle arrest in G1, induces cell cycle arrest at the G1/S checkpoint, blocks the G1/S transition or inhibits DNA synthesis. \n3. The method according to claim 2, wherein said one or more pharmaceutical agent(s) include(s) sodium valproate.\n4. The method according to claim 2, wherein said one or more pharmaceutical agent(s) include(s) a retinoid or retinoid receptor selective ligand, an ansamycin, a vitamin D analogue, a steroid or glucocorticoid, or an alpha adrenergic receptor antagonist.\n5. The method according to claim 1, wherein the pharmaceutical agent is an inhibitor of the G0/G1 transition.\n6. The method according to claim 1, wherein the pharmaceutical agent induces cell cycle arrest in the G0/G1 phase.\n7. The method according to claim 1, wherein the pharmaceutical agent is sodium valproate.\n8. The method according to claim 1, wherein the pharmaceutical agent blocks cell cycle progression in G1.\n9. The method according to claim 1, wherein the pharmaceutical agent induces cell cycle arrest in G1.\n10. The method according to claim 1, wherein the pharmaceutical agent induces cell cycle arrest at the G1/S checkpoint.\n11. The method according to claim 1, wherein the pharmaceutical agent blocks the G1/S transition.\n12. The method according to claim 1, wherein the pharmaceutical agent inhibits DNA synthesis.\n13. The method according to claim 1, wherein the pharmaceutical agent is: \n(a) a retinoid or retinoid receptor selective ligand; \n(b) an ansamycin; \n(c) a steroid or glucocorticoid; or \n(d) an alpha adrenergic receptor antagonist. \n14. The method according to claim 13, wherein the candidate pharmaceutical agent is alpha adrenergic receptor antagonist, and wherein said alpha adrenergic receptor antagonist is doxazosin."]


First Claim
['1. A steam cleaning appliance, comprising: \na steam generation unit; \na steam cleaning applicator; and \na flexible steam conduit configured to guide steam from the steam generation unit to a steam inlet for the steam cleaning applicator; \nwherein the steam cleaning applicator is connectable to the steam conduit; \nthe steam cleaning applicator is rotatable relative to the steam conduit in either rotational direction without loosening the connection of the steam applicator to the steam conduit; \nthe steam cleaning applicator has an end-to-end direction and \nthe steam cleaning applicator is rotatable by at least 360 degrees relative to the steam conduit in either rotational direction about the end-to-end direction of the steam cleaning applicator, without loosening the connection of the steam cleaning applicator to the steam conduit.'
 '1. A vibration suppressor system for reducing vibrations in a rotating system, comprising: \nan annular electric motor system provided about an axis of rotation of the rotating system, said annular electric motor system including an annular bearing and a first mass supported within said annular bearing, said first mass guided about said axis of rotation by said annular bearing, wherein said first mass is eccentric, said first mass including a truck being at least partially conductive, said annular electric motor system further including a stator axially spaced-apart, relative to said axis of rotation, from said truck; \na control system in communication with said annular electric motor system to control rotation of said first mass about said axis of rotation to reduce in-plane vibration of the rotating system; \nwherein a second mass is supported within said annular bearing, and wherein said second mass is eccentric; and \nwherein said control system independently controls rotation of said first and second masses about said axis of rotation.'
 '1. A powder for use in a dry powder inhaler, the powder comprising active particles and carrier particles for carrying the active particles, the powder further including particles of additive material attached to the surfaces of the carrier particles, wherein particles of additive material adhere to the high energy sites on the surfaces of the carrier particles and wherein the powder comprises more than one additive material, wherein the additive material includes one or more surface active materials; wherein additive particles are also present as agglomerates and act as carriers of the active particles and are separate from or separable from the surfaces of the carrier particles with active particles attached to surfaces of the agglomerates.'
 ...
 '1. An adenoviral vector suitable for use in the treatment of a tumor disease, wherein the tumor cells express YB-1 and have YB-1 in the nucleus, wherein the adenoviral vector comprises an adenoviral E2 late promoter or a fragment thereof and a nucleic acid under the control of the adenoviral E2 late promoter or the fragment thereof, wherein the nucleic acid being selected from the group consisting of adenoviral gene E1B, adenoviral gene E4orf6, and combination thereof; and wherein the adenoviral E2 late promoter or fragment thereof is regulated by YB-1.'
 '1. An implant for securing a spinal stabilization bar to a vertebra, the implant comprising: \na bone screw having a longitudinal screw axis and comprising a bone penetration end disposed at a first end of the longitudinal screw axis and a protrusion end disposed at a second end of the longitudinal screw axis distal from the bone penetration end; \na clamping head having a longitudinal clamping head axis and comprising a support head disposed at a first end of the longitudinal clamping head axis,  \na drive coupler disposed at a second end of the longitudinal clamping head axis and configured for engagement with a drive tool to impart rotation to the bone screw, \na stabilization bar support configured to receive a stabilization bar from the side of the implant, and \na clamp configured to secure the stabilization bar to the stabilization bar support; and \na universal joint coupling the bone screw and the clamping head.'
 "1. A method of selecting a candidate compound for use in the treatment of Alzheimer's disease in a human patient, which method comprises: \n(a) incubating proliferating lymphocytes of said patient in the presence of one or more pharmaceutical agent(s), wherein said proliferating lymphocytes exhibit a cell cycle regulatory defect at the G1/S phase transition and wherein said pharmaceutical agent(s) are: \ni) inhibitors of cell cycle re-entry or progression to the G1/S transition; or \nii) inhibitors of progression of the cell cycle through the G1/S transition point; and \n(b) screening and selecting a compound that corrects said regulatory defect at the G1/S transition in said proliferating lymphocytes as a candidate compound for use in the treatment of Alzheimer's disease in said patient."]


Independent Claims
['1. A steam cleaning appliance, comprising:  a steam generation unit; a steam cleaning applicator; and a flexible steam conduit configured to guide steam from the steam generation unit to a steam inlet for the steam cleaning applicator; wherein the steam cleaning applicator is connectable to the steam conduit; the steam cleaning applicator is rotatable relative to the steam conduit in either rotational direction without loosening the connection of the steam applicator to the steam conduit; the steam cleaning applicator has an end-to-end direction and the steam cleaning applicator is rotatable by at least 360 degrees relative to the steam conduit in either rotational direction about the end-to-end direction of the steam cleaning applicator, without loosening the connection of the steam cleaning applicator to the steam conduit.'
 '1. A vibration suppressor system for reducing vibrations in a rotating system, comprising:  an annular electric motor system provided about an axis of rotation of the rotating system, said annular electric motor system including an annular bearing and a first mass supported within said annular bearing, said first mass guided about said axis of rotation by said annular bearing, wherein said first mass is eccentric, said first mass including a truck being at least partially conductive, said annular electric motor system further including a stator axially spaced-apart, relative to said axis of rotation, from said truck; a control system in communication with said annular electric motor system to control rotation of said first mass about said axis of rotation to reduce in-plane vibration of the rotating system; wherein a second mass is supported within said annular bearing, and wherein said second mass is eccentric; and wherein said control system independently controls rotation of said first and second masses about said axis of rotation. | 9. A vibration suppressor system for reducing vibrations in a rotating system, comprising:  an annular electric motor system provided about an axis of rotation of the rotating system, said annular electric motor system including an annular bearing and a first mass supported within said annular bearing, said first mass guided about said axis of rotation by said annular bearing, wherein said first mass is eccentric, and wherein said axis of rotation intersects said first mass; and a control system in communication with said annular electric motor system to control rotation of said first mass about said axis of rotation to reduce in-plane vibration of the rotating system; wherein a second mass is supported within said annular bearing, wherein said second mass is eccentric, and wherein said axis of rotation intersects said second mass; and wherein said control system independently controls rotation of said first and second masses about said axis of rotation. | 12. A vibration suppressor system for reducing vibrations in a rotating system, comprising:  an annular electric motor system provided about an axis of rotation of the rotating system, said annular electric motor system including an annular bearing and first and second masses supported within said annular bearing, said first and second masses guided about said axis of rotation by said annular bearing, wherein said first and second masses are eccentric, said first and second masses each including a truck which is at least partially conductive, said annular electric motor system further including at least one stator axially spaced-apart, relative to said axis of rotation, from said trucks; a control system in communication with said annular electric motor system to control rotation of said first and second masses about said axis of rotation to reduce in-plane vibration of the rotating system; and wherein said first and second masses are disk-shaped and each span substantially an entirety of an inner diameter of said annular bearing.'
 '1. A powder for use in a dry powder inhaler, the powder comprising active particles and carrier particles for carrying the active particles, the powder further including particles of additive material attached to the surfaces of the carrier particles, wherein particles of additive material adhere to the high energy sites on the surfaces of the carrier particles and wherein the powder comprises more than one additive material, wherein the additive material includes one or more surface active materials; wherein additive particles are also present as agglomerates and act as carriers of the active particles and are separate from or separable from the surfaces of the carrier particles with active particles attached to surfaces of the agglomerates. | 18. A powder for use in a dry powder inhaler, the powder including additive and carrier particles for carrying the additive particles, the powder further including active particles which adhere to the additive particles on the carrier particles, wherein the additive material is magnesium stearate, wherein the additive material is present in an amount of not more than 1% by weight based on the weight of the powder; wherein additive particles are also present as agglomerates and act as carriers of the active particles and are separate from or separable from the surfaces of the carrier particles with active particles attached to surfaces of the agglomerates. | 24. A powder for use in a dry powder inhaler, the powder comprising:  active particles; carrier particles for carrying the active particles; and particles of additive material attached to surfaces of the carrier particles; wherein the particles of additive material adhere to high energy sites on the surfaces of the carrier particles and provide a discontinuous covering for the carrier particles, wherein the powder comprises more than one additive material in the form of a powder, and wherein the additive material includes one or more surface active materials; wherein additive particles are also present as agglomerates and act as carriers of the active particles and are separate from or separable from the surfaces of the carrier particles with active particles attached to surfaces of the agglomerates.'
 ...
 '1. An adenoviral vector suitable for use in the treatment of a tumor disease, wherein the tumor cells express YB-1 and have YB-1 in the nucleus, wherein the adenoviral vector comprises an adenoviral E2 late promoter or a fragment thereof and a nucleic acid under the control of the adenoviral E2 late promoter or the fragment thereof, wherein the nucleic acid being selected from the group consisting of adenoviral gene E1B, adenoviral gene E4orf6, and combination thereof; and wherein the adenoviral E2 late promoter or fragment thereof is regulated by YB-1.'
 '1. An implant for securing a spinal stabilization bar to a vertebra, the implant comprising:  a bone screw having a longitudinal screw axis and comprising a bone penetration end disposed at a first end of the longitudinal screw axis and a protrusion end disposed at a second end of the longitudinal screw axis distal from the bone penetration end; a clamping head having a longitudinal clamping head axis and comprising a support head disposed at a first end of the longitudinal clamping head axis,  a drive coupler disposed at a second end of the longitudinal clamping head axis and configured for engagement with a drive tool to impart rotation to the bone screw, a stabilization bar support configured to receive a stabilization bar from the side of the implant, and a clamp configured to secure the stabilization bar to the stabilization bar support; and a universal joint coupling the bone screw and the clamping head. | 12. An implant for securing a spinal stabilization bar to a vertebra, the implant comprising:  an elongated bone screw having a longitudinal screw axis; a clamping head having a longitudinal clamping head axis; a universal joint coupling the bone screw and the clamping head configured for transmission of a rotation of the clamping head around its longitudinal clamping head axis to a rotation of the bone screw around its longitudinal screw axis while an angle between the longitudinal clamping head axis and the longitudinal screw axis is non-zero; a stabilization bar support configured to receive a stabilization bar; and a stabilization bar support configured to permit said transmission while the bar is attached to the implant. | 17. A system for spinal stabilization comprising:  a plurality of implants each comprising:  an elongated bone screw having a longitudinal screw axis, a clamping head having a longitudinal clamping head axis, a universal joint coupling the bone screw and the clamping head configured for transmission of a rotation of the clamping head around its longitudinal clamping head axis to a rotation of the bone screw around its longitudinal screw axis while an angle between the longitudinal clamping head axis and the longitudinal screw axis is non-zero, a stabilization bar support configured to receive a stabilization bar and permit said transmission while the bar is attached to the implant; and an elongated stabilization bar having a first distal end and a second distal end, the bar comprising a pair of generally parallel rods having a space between the rods, with the space having an opening along at least one of the distal ends of the bar, and with the space being sufficient sized to allow passage of the clamping head along a path from the opening to a point between the distal ends.'
 "1. A method of selecting a candidate compound for use in the treatment of Alzheimer's disease in a human patient, which method comprises:  (a) incubating proliferating lymphocytes of said patient in the presence of one or more pharmaceutical agent(s), wherein said proliferating lymphocytes exhibit a cell cycle regulatory defect at the G1/S phase transition and wherein said pharmaceutical agent(s) are: i) inhibitors of cell cycle re-entry or progression to the G1/S transition; or ii) inhibitors of progression of the cell cycle through the G1/S transition point; and (b) screening and selecting a compound that corrects said regulatory defect at the G1/S transition in said proliferating lymphocytes as a candidate compound for use in the treatment of Alzheimer's disease in said patient."]


Description
['CROSS-REFERENCE TO RELATED APPLICATIONS \n\nThis application is a continuation of U.S. application Ser. No. 12/567,718, entitled \x93Steam Appliance\x94, filed Sep. 25, 2009, which is herein incorporated by reference in its entirety. \n\nBRIEF DESCRIPTION OF THE DRAWINGS \n\nThe accompanying drawings are not intended to be drawn to scale. For purposes of clarity, not every component may be labeled in every drawing. In the drawings: \n\nFIG. 1  is a side view of a steam appliance system according to one embodiment of the invention;\n\nFIG. 2  is a side view of a first portion of a connector according to one embodiment of the invention;\n\nFIG. 3  is a cross-sectional view of a second portion of a connector configured to engage with the first portion illustrated in FIG. 2; and\n\nFIG. 4  is an exploded perspective view of components of the second connector portion illustrated in FIG. 3.\n\nFIELD OF THE INVENTION \n\nThe invention relates generally to steam appliances, and more specifically to a steam applicator that is connectable to a conduit but constructed and arranged be rotated without loosening or disengaging the connection. \n\nDISCUSSION OF THE RELATED ART \n\nSteam appliances are used in the home to apply steam to floors for cleaning and sanitizing. Various types of steam appliances are known, including canister steam appliances and self-contained steam mops for example. Canister steam appliances typically include a rollable steam generation unit, a hose to transfer the steam from the steam generation unit, a pole, and a mop head or other accessory which is connected to the end of the pole. Self-contained steam mops include a steam generation unit mounted directly on the pole. Handheld steam appliances typically include a container and a nozzle for discharging steam directly from the mouth of the container. \n\nSUMMARY \n\nEmbodiments of the invention provided herein are directed to steam appliances in which a steam applicator is connectable to the steam appliance, but the steam applicator is permitted to rotate without loosening or disengaging the connection of the steam applicator to the steam appliance. \n\nAccording to one embodiment of the invention, a steam appliance includes a steam generation unit, a steam applicator, and a steam conduit configured to guide steam from the steam generation unit to a steam inlet for the steam applicator. The steam applicator is connectable to the steam conduit, and the steam applicator is rotatable relative to the steam conduit in either rotational direction without loosening the connection of the steam applicator to the steam conduit. \n\nAccording to another embodiment of the invention, a method of using a steam applicator having a handle with a end-to-end direction includes acts of grasping the handle with a first hand, grasping a steam conduit with a second hand, bringing a first threaded portion of the steam applicator into contact with a second threaded portion of the steam conduit, and connecting the steam applicator to the steam conduit. The method further includes using the steam applicator to apply steam to an object, and rotating the handle in either rotational direction about the end-to-end direction of the handle to rotate the steam applicator, wherein the rotation of the handle does not loosen the connection of the steam applicator to the steam conduit. Also included is a method of disconnecting the steam applicator from the steam conduit by simultaneously rotating the first threaded portion relative to the second threaded portion and applying an axial force between the conduit and the steam applicator, the axial force being sufficient to overcome a force applied by a resilient element, such that at least one of the first and second threaded portions is altered from a configuration in which the at least one threaded portion is rotatable relative to whichever of the steam applicator and the steam conduit that it is positioned on, to a configuration in which the at least one threaded portion is not rotatable relative to whichever of the steam applicator and the steam conduit that it is positioned on. \n\nAccording to a further embodiment of the invention, a steam appliance includes a steam generation unit, a steam applicator having a handle, a steam conduit to guide steam from the steam generation unit to the steam applicator, and means for mechanically connecting the steam conduit to the handle of the steam applicator. The handle is permitted to repeatedly rotate relative to the steam conduit in either rotation direction about an end-to-end direction of the handle without loosening the connection of the handle to the steam conduit. \n\nVarious embodiments of the present invention provide certain advantages. Not all embodiments of the invention share the same advantages and those that do may not share them under all circumstances. \n\nFurther features and advantages of the present invention, as well as the structure of various embodiments of the present invention are described in detail below with reference to the accompanying drawings. \n\nDETAILED DESCRIPTION \n\nApplicants have recognized the importance of providing a steam applicator assembly which can be freely rotated without compromising the connection of the applicator assembly to a steam conduit. The ability to rotate the steam applicator can be particularly important when the steam applicator assembly is a handheld assembly that is attached to a flexible hose or other flexible conduit because a user may wish to rotate the steam applicator without twisting or kinking the hose. It is also desirable to prevent unintentional disengagement of the steam applicator during rotation of the steam applicator to avoid steam loss and the inconvenience of reconnecting the steam applicator. \n\nAccording to some embodiments of the invention, a steam appliance permits a user to engage and disengage the steam applicator with the same type of motion and without detaching any components. In some embodiments, disconnecting the steam applicator requires two distinct motions. For example, a user may need to push the steam applicator toward the steam conduit and then twist the conduit to separate the steam conduit and the steam applicator. \n\nAccording to one embodiment of the invention, a steam applicator is connected to a flexible steam conduit with a threaded connector configuration which allows rotation of the steam applicator relative to the steam conduit during use without compromising the connection. The threaded connector includes an external thread portion and an internal thread portion. One of the thread portions, for example the internal thread portion, is positioned within an element such as a handle on the steam applicator. The internal thread portion is constructed and arranged to rotate within the handle. By allowing the internal thread portion to \x93float\x94 within the handle, friction between the thread portions rotates the internal thread portion within the handle, thereby substantially preventing the complementary external thread portion from being fully twisted into or out of the internal thread portion. To successfully twist the external thread portion into or out of the internal thread portion, the user pushes the two thread portions toward each other, which temporarily fixes the internal thread portion to the handle, thereby permitting relative rotation of the two thread portions. \n\nA steam appliance system  100 including two attachable steam applicators 102, 104 is shown in FIG. 1. Steam applicators 102, 104 each may include a handle 107 which is permanently or detachably attached to the applicator. In the embodiment of FIG. 1, steam appliance system 100 includes a steam generation unit 108, a steam conduit 110, and attached steam applicator 102. Steam generation unit 108 may include any suitable type of steam generation system, for example a cool water reservoir 112 and an aluminum die-cast steam generator (not shown). In some embodiments, water may be heated to its boiling point within its reservoir to create steam. It should be noted that the method of steam generation is not intended to be a limiting aspect of the invention.\n\nIn some embodiments, the steam generation unit  108 is handheld, while in other embodiments the steam generation unit may include a shoulder strap, or include wheels or other rollers.\n\nSteam conduit  110 is a flexible hose in some embodiments. Steam conduit 110 may be attachable to steam generation unit 108 with any suitable attachment 114, including a removable connector, such as a bayonet connector.\n\nOne particular embodiment of a steam appliance which permits rotation a steam applicator without compromising the connection of the steam applicator to the steam appliance is shown in  FIGS. 2-4. In this embodiment, a steam appliance includes an externally-threaded connector portion 202 attached to steam conduit 110. A hand grasp portion 206 is attached to steam conduit 110 and threaded connector portion 202 for the user to grip when attaching or detaching steam conduit 110 and handle 107.\n\nSteam conduit includes an elongated stem  208 to guide steam through handle 107 and to a steam outlet 212. O-rings 210 or other seal elements may be positioned on stem 208 to establish a seal with the steam applicator, whether that seal be within the handle of the steam applicator, or within the steam applicator itself. The stem and sealing aspects of the illustrated embodiment are not intended to be limiting. A stress release sleeve 214 may be included at the junction of steam conduit 110 and hand grasp portion 206 in some embodiments.\n\nAn internally-threaded connector portion  302 with threads 304 is positioned within handle 107 in the embodiment illustrated in FIG. 3. Connector portion 302 is permitted to rotate within handle 107, and is also permitted to move axially between stops 306 and 308. Connector portion 302 is biased away from a lock element 310 by a coil spring 312. Instead of a spring, any suitable resilient element may be used to bias connector portion 302 away from lock element 310. For example, a compressible resilient foam gasket may be used in some embodiments. In still other embodiments, a constant force spring, an elastic band, or any other suitable tensioning device, may bias connector portion 302 away from locking element 310 by pulling on connector portion 302.\n\nWhen a user initially inserts externally-threaded connector portion  202 into internally-threaded connector portion 302, rotating the two portions relative to each other will not result in a mating of the threaded portions because connector portion 302 rotates with connector portion 202. However, when the user pushes connector portion 302 against locking element 310 by providing an axial force of at least a threshold force \x83t to overcome the force provided by coil spring 312 connector portion is prevented from rotating by more than a small angle because locking tabs 314 on connector portion 302 are rotated into abutment with locking tabs 316 on the locking element 310. With locking element 310 prevented from rotating, connector portion 202 can be twisted into mating engagement with connector portion 302. Locking element 310 is prevented from moving axially away from connector portion 302 by a stop 318.\n\nIn this manner, two distinct motions are required of the user to attach or remove a steam applicator from steam conduit  110. While in the illustrated embodiment the two distinct motions include an axial force and a twisting force acting simultaneously, other multiple distinct action configurations may be used. For example, in some embodiments, a ball and groove quick disconnect coupling is used to connect a steam conduit to a steam applicator. In such an embodiment, a first motion may include moving a locking collar, and a second motion may include pulling the handle of the steam applicator away from the steam conduit. Some embodiments may require two or more distinct motions to remove a steam applicator, while allowing attachment of a steam applicator with only a single motion.\n\nBy requiring two or more distinct motions to remove a steam applicator, unintended disengagement or loosening of the steam applicator during use of the steam appliance may be prevented. For example, the user may rotate the steam applicator in either direction about an end-to-end direction of the steam application when cleaning surfaces, and it may be beneficial to avoid having the steam conduit rotate as a result of the steam applicator rotations. By allowing connector portion  302 to rotate relative to handle 107, handle 107 can rotate without twisting steam conduit 110 and with loosening the engagement of the two threaded connectors. For purposes herein, loosening a connection is intended to include compromising a connection. For example, in some embodiments, a connection may become less than fully engaged such that the connection is at risk of disengaging, yet the connection may not permit perceptible movement of the two connected components relative to one another.\n\nIn some embodiments, one or more rotation stops may be included to limit the rotation angle of the steam applicator in either rotation direction (e.g., clockwise and counterclockwise about an end-to-end direction of the steam applicator). In such an embodiment, the steam applicator is permitted to rotate a certain amount, for example by permitting connector portion  302 to rotate, but the steam applicator rotation is prevented from further rotations by the rotation stops. The rotation stops may include one or more tabs (not shown) protruding from an interior wall of handle 107 between stops 306 and 308. In some embodiments, the steam applicator is permitted to rotate 180 degrees in either direction, and in some embodiments, the steam applicator is permitted to rotate 360 degrees in either direction.\n\nThe embodiments described above allow for a tool-free attachment and removal of steam applicators from the steam appliance. In some embodiments, however, a tool may be used. \n\nWhile embodiments described herein are directed to rotations of a steam applicator or a handle about an end-to-end direction of the steam application or the handle, in some embodiments, pitch and/or yaw rotations may be permitted as well. A universal joint may be used in addition to, or instead of, the structures described herein. \n\nFor purposes herein, the terms \x93connect\x94, \x93connected\x94, \x93connection\x94, \x93attach\x94, \x93attached\x94 and \x93attachment\x94 refer to direct connections and attachments, indirect connections and attachments, and operative connections and attachments. For example, steam applicator  102 is considered to be connected to steam conduit 110 even though steam applicator is directly connected to handle 107 which is, in turn, connected to steam conduit 110. Also for purposes herein, the terms \x93connectable\x94, \x93attachable\x94, \x93removable\x94, etc. refer both to components which can be connected, attached, removed, etc., and also refer to components which are connected, attached and removed.\n\nFor ease of understanding, and without limiting the scope of the invention, the embodiments to which this disclosure is addressed are described above particularly in connection with a handheld portable steam appliance. It should be appreciated, however, that the present invention can be embodied in other types of steam appliances. Additionally, while the steam applicators described above employ steam pocket technology, other types of steam applicators may be used in conjunction with embodiments disclosed herein. \n\nHaving thus described several aspects of at least one embodiment of this invention, it is to be appreciated various alterations, modifications, and improvements will readily occur to those skilled in the art. Such alterations, modifications, and improvements are intended to be part of this disclosure, and are intended to be within the spirit and scope of the invention. Accordingly, the foregoing description and drawings are by way of example only.'
 "RELATED APPLICATIONS \n\nThe present application is a divisional of prior U.S. patent application Ser. No. 12/353,217, filed Jan. 13, 2009, which claims the benefit U.S. Provisional Application No. 61/070,097, filed Mar. 20, 2008. The '217 and '097 applications are herein incorporated by reference in their entirety. \n\nBRIEF DESCRIPTION OF THE DRAWINGS \n\nThe various features and advantages of this disclosure will become apparent to those skilled in the art from the following detailed description of the currently disclosed embodiment. The drawings that accompany the detailed description can be briefly described as follows: \n\nFIG. 1  is a general perspective view of an exemplary rotary wing aircraft embodiment for use with the present disclosure;\n\nFIG. 2  is a side sectional view of a helicopter main rotor, including a main rotor shaft having a vibration suppression system mounted to the upper mast or shaft extension member of the main rotor system;\n\nFIG. 3A  is a schematic perspective view of a vibration suppressor system having adjacent annular stators;\n\nFIG. 3B  is a sectional view through the system of FIG. 3A along line 3B-3B;\n\nFIG. 3C  is an expanded perspective view of a single mass which rotates upon an annular stator;\n\nFIG. 4A  is a top view of another non-limiting embodiment of a vibration suppressor system;\n\nFIG. 4B  is a cross-sectional view taken along line 4B-4B in FIG. 4A;\n\nFIG. 4C  is a cross-sectional view taken along line 4C-4C in FIG. 4B;\n\nFIG. 5A  is another non-limiting embodiment of a vibration suppressor system with ring bearings that support disk-shaped eccentric masses;\n\nFIG. 5B  is a cross-sectional view taken along line 5B-5B in FIG. 5A;\n\nFIG. 5C  is a cross-sectional view taken along line 5B-5B in FIG. 5A of another non-limiting embodiment that radially compresses the vibration suppressor system by location of eccentric masses between the two ring bearings;\n\nFIGS. 6A-6E  are schematic top views of a vibration suppressor system with segmental propulsion;\n\nFIG. 7A  is another embodiment of the vibration suppressor system having electromagnets arranged around an inner ring;\n\nFIG. 7B  is a top view of another vibrating suppressor system having electromagnets arranged around an outer ring;\n\nFIG. 8A  is a schematic representation of a condition where the maximum force is produced by one annular stator of the vibration suppressor system; and\n\nFIG. 8B  is a schematic representation of a condition where an intermediate force is produced by one annular stator of the vibration suppressor system; and\n\nFIG. 8C  is a schematic representation of a condition where a minimum force is produced by one annular stator of the vibration suppressor system.\n\nBACKGROUND \n\nThe present disclosure relates to a vibration suppressor system. \n\nVibration suppression is often utilized to null vibrations associated with a rotating system. Such vibrations, when left unattenuated may lead to crew and structural fatigue and premature failure of system components. The vibrations may also be transmitted through adjacent support structure to other areas and systems remote from the vibration source. Consequently, it may be desirable to suppress these vibrations proximal the vibration source. \n\nOne application which exemplifies vibration isolation/absorption is the main rotor system of a rotary-wing aircraft. Typically, the main rotor system includes a hub system which drives a plurality of rotor blades subject to a variety of aerodynamic and gyroscopic loads. For example, as each rotor blade advances or retreats relative to the freestream airflow, each rotor blade experiences a rise and fall of in-plane aerodynamic drag. Furthermore, as the tip of each rotor blade advances with each revolution of the rotor system, the relative velocity at the blade tip may approach supersonic Mach numbers. As such, variations may occur at various coefficients which define blade performance (e.g., moment, lift and drag coefficients). Moreover, gyroscopic and Coriolis forces are generated which may cause the blades to \x93lead\x94 or \x93lag.\x94 These effects, as well as others, generate vibrations, which, if not suppressed, are transmitted to the airframe, typically through the main rotor gearbox mount structure. \n\nVarious vibration suppressor systems have been devised to suppress vibrations. Mast-mounted vibration isolators suppress or isolate in-plane vibrations at a location proximal to the source. Transmission, cabin or cockpit absorbers reduce vibrations at a location remote from the source. \n\nMast-mounted vibration isolators having a plurality of resilient arms (i.e., springs) extend in a spaced-apart spiral pattern between a hub attachment fitting and a ring-shaped inertial mass. Several pairs of spiral springs are mounted to and equiangularly arranged with respect to both the hub attachment fitting and the inertial mass so as to produce substantially symmetric spring stiffness in an in-plane direction. The spring-mass system, i.e., spiral springs in combination with the ring-shaped mass, is tuned in the non-rotating system to a frequency equal to N*rotor RPM (e.g., 4P for a four-bladed rotor) at normal operating speed, so that in the rotating system the spring mass system will respond to both N+1 and N?1 frequency vibrations (i.e., 3P and 5P for a four-bladed rotor). N is the number of rotor blades. \n\nWhile the spiral spring arrangement produces a relatively small width dimension (i.e., the spiraling of the springs increases the effective spring rate), the height dimension of each vibration isolator is increased to react out-of-plane loads via upper and lower pairs of spiral springs. This increased profile dimension increases the profile area, and consequently the profile drag produced by the isolator. The spiral springs must also be manufactured to relatively precise tolerances to obtain the relatively exact spring rates necessary for efficient operation. As such, manufacturing costs may be significant. Additionally, the weight of this device is very high, thus reducing the useful payload of the helicopter. Furthermore, these vibration isolators are passive devices which are tuned to a predetermined in-plane frequency and cannot be adjusted in-flight to isolate in-plane loads which may vary in frequency depending upon flight regime. \n\nYet another general configuration of a mast-mounted vibration isolator is referred to as a \x93bifilar.\x94 Bifilars include a hub attachment fitting connected to and driven by the rotorshaft with a plurality of radial arms which project outwardly from the fitting with a mass coupled to the end of each arm via a rolling pin arrangement. A pin rolls within a cycloidally-shaped bushing to permit edgewise motion of each mass relative to its respective arm. The geometry of the pin arrangement in combination with the centrifugal forces acting on the mass (imposed by rotation of the bifilar) results in an edgewise anti-vibration force at a 4 per revolution frequency which is out-of-phase with the large 4 per revolution (\x934P\x94) in-plane vibrations of the rotor hub for a 4 bladed rotor system. The frequency of 4P is the frequency as observed in a nonrotating reference system such as the airframe. \n\nPairs of opposed masses act in unison to produce forces which counteract forces active on the rotor hub. For the masses to produce the necessary shear forces to react the in-plane vibratory loads of the rotor system, counteracting bending moments are also produced. These force couples may impose relatively large edgewise bending loads in the radial arms, and consequently, the geometry thereof must produce the necessary stiffness (EI) at the root end of the arms. As such, these increased stiffness requirements result in relatively large and heavy bifilar arms. \n\nWhile the bifilar system has proven effective and reliable, the weight of the system, nearly 210 lbs for one typical system, may be detrimental to the overall lifting capacity of the aircraft. Furthermore, the pin mount for coupling each mass to the respective radial arm may require periodic removal and replacement, which may increase the Direct Maintenance Costs (DMC) of aircraft operations. \n\nSUMMARY \n\nA vibration suppressor according to an exemplary aspect of the present disclosure includes an annular electric motor system defined about an axis of rotation of a rotating system, and a control system in communication with the annular electric motor system to independently control rotation of at least two masses about the axis of rotation to reduce in-plane vibration of the rotating system. \n\nA method of reducing vibrations in a rotary-wing aircraft main rotor system having N number of blades which rotate about an axis of rotation at a rotational speed of 1P such that the main rotor system produces NP vibrations according to an exemplary aspect of the present disclosure includes independently rotating a multiple of independently rotatable masses disposed about an axis of rotation defined by the main rotor system and controlling a relative angular position of the multiple of independently rotatable masses to reduce the NP vibrations of the main rotor system. \n\nDETAILED DESCRIPTION OF THE DISCLOSED EMBODIMENT \n\nFIG. 1  schematically illustrates a rotary-wing aircraft 10 having a main rotor system 12. The aircraft 10 includes an airframe 14 having an extended tail 16 which mounts an anti-torque system such as a tail rotor system 18. The main rotor assembly 12 is driven about an axis of rotation R through a main rotor gearbox (illustrated schematically at MRG) which is powered by one or more engines E. The main rotor system 12 includes a multiple of rotor blades 20 mounted to a rotor hub 22. The rotor hub 22 is driven about the axis of rotation R by a main rotor shaft 24 which is driven by the main rotor gearbox MRG. Although a particular helicopter configuration is illustrated and described in the disclosed non-limiting embodiment, other configurations and/or machines, such as high speed compound rotary wing aircraft with supplemental translational thrust systems, dual contra-rotating, coaxial rotor system aircraft, turbo-props, tilt-rotors and tilt-wing aircraft, will also benefit herefrom.\n\nA vibration suppressor system  30 is mounted to the main rotor system 12 for rotation therewith and may thereby be referred to as a hub mounted vibration suppressor (HMVS). Vibratory forces active on the main rotor system 12 are generated by a variety of factors, although the dominant vibrations originate from aerodynamic and/or gyroscopic forces generated by each rotor blade 20.\n\nA four bladed rotor system, for example, produces 3P vibratory loads, i.e., in a single revolution, the magnitude of the load vector varies from a minimum to a maximum value three times in the rotating frame of reference. The 3P vibratory loads resolve into 4P vibration in a non-rotating frame of reference such as the airframe  14 due to the addition of the 1P rotor rotational speed. In addition, 5P vibratory loads are produced in a direction opposite the rotational direction of the main rotor system. The 5P vibratory loads also resolve into 4P vibration in the non-rotating frame of reference due to the subtraction of the opposite 1P rotor rotational speed. While a variety of factors influence the vibratory spectrum of a rotor system, such vibrations are generally a result of each rotor blade experiencing maximum lift when advancing and minimum lift when retreating. In another example, a seven bladed rotor system\x97having 6P co-rotation and 8P counter-rotational vibratory load resolve into a 7P vibration in the non-rotating frame of reference such as the airframe 14.\n\nReferring to  FIG. 2, the vibration suppressor system 30 generally includes an annular electric motor system 32, a control system 34 and a power system 36. The controller can be included in the electric motor system 32 i.e. it is typically in the rotating system) The annular electric motor system 32 may be contained within a housing 38 for rotation with the main rotor system 12. The annular electric motor system 32 in one non-limiting embodiment includes a first and second annular stator 40A, 40B mounted within the housing 38. Each stator 40A, 40B represents a primary analogous to a fixed portion of a linear electric motor. The first stator 40A is defined about the axis of rotation R to support a first set of masses MA1, MA2, which are independently rotatable about the first stator 40A (also illustrated in FIG. 3A). The second stator 40B is defined about the axis of rotation R to support a second set of masses MB1, MB2 which are independently rotatable about the second stator 40B (also illustrated in FIG. 3A). The first stator 40A may be located adjacent the second stator 40B in a stacked arrangement which facilitates a light weight and low profile arrangement which may be readily mounted atop the main rotor hub 22 within the housing 38.\n\nAlternatively, the first stator  40A and second stator 40B may be located in the non-rotating system, i.e., in under the main rotor gearbox MRG. In this non-limiting embodiment, the MA1, MA2 would rotate at 4P and MB1 and MB2 would also rotate at 4P but in the opposite direction.\n\nThe control system  34 issues control signals to an amplifier 34A of the annular electric motor system 32 to control the rotational speed and relative angular position of the masses MA1, MA2, MB1, MB2 of the vibration suppressor system 30. The power system 36 in one non-limiting embodiment may be the aircraft electrical bus, which delivers electrical power created by a main rotor gearbox powered generator 44. The masses MA1, MA2, MB1, MB2 each represent an independent secondary analogous to a moving part of a linear electric motor. The control system 34 may include a speed sensor 42 which senses the instantaneous rotational speed 1P of the main rotor shaft 24 to control the rotational velocity and relative angular position of each of the masses the masses MA1, MA2, MB1, MB2.\n\nAlthough the speed sensor  42 in one non-limiting embodiment may be a dedicated unit which directly measures the main rotor system 12 speed, the control system 34 may alternatively or additionally obtain the speed information from the generator 44 within the power system 36. The generator 44 turns at a predefined speed relative to the main rotor system 12 and may, in one non-limiting embodiment include a 5 kVa generator which provides a 115 volt, 400 Hz 3 phase potential to generate power for the vibration suppressor system 30 as well as provide the main rotor system speed reference signal. The generator 44 is mechanically driven by the MRG such that the rotational speed of the generator is a fixed multiple of the main rotor NP frequency. The electrical phase of the generator voltage is a fixed multiple of the generator rotational speed. Thus, the electrical voltage phase signal is a reflection of the NP frequency. As the rotor speed and NP frequency vary while in flight, the electrical voltage phase signal also varies and is perfectly slaved thereto, i.e. a fixed multiple of the main rotor speed. This makes the voltage signal an effective reference signal that will exactly track main rotor system speed. Hence, the control system 34 may use the phase information to issue the appropriate low power control signals to the amplifier 34A which issues high power signals to the vibration suppression system 30.\n\nWhile the vibration suppressor system  30 may employ a control system 34 with a predefined schedule or model of the vibrations, e.g., at prescribed rotor speeds, another non-limiting embodiment utilizes a vibration sensing system 46 with at least one vibration feedback sensor 48 for issuing vibration signals indicative of the vibrations (e.g., amplitude, frequency and phase) at one or more locations within the fixed frame of reference, e.g., MRG, fuselage, cabin, or cockpit. It should be understood that the vibration sensing system 46 may alternatively be integrated within the control system 34. The control system 34 samples vibration levels at predefined intervals or rates to identify a trend\x97positive (lower vibration levels) or negative (larger vibration levels) such that as vibration levels change, the control system 34 issues modified control signals the vibration suppressor system 30 until a combination of rotational speed and angular position of the masses MA1, MA2, MB1, MB2 minimize vibratory loads in the main rotor system 12.\n\nPower may be transferred from the stationary system to the rotating system via a slip ring  50 or the like. Only a small amount of additional weight is required inasmuch as the slip ring 50 is typically pre-existing in a rotary wing aircraft for other systems e.g., a rotor blade de-ice system. This slip ring 50 may also be used to communicate control signals when the control system 34 is mounted in the airframe 14 rather than on the main rotor system 12. Alternatively, the control system 34 may be located within the vibration suppressor system 30 such that the power system 36 communicates power to the slip ring 50 then to the control system 34.\n\nReferring to  FIG. 3A, one non-limiting embodiment of the vibration suppressor system 30 includes the first annular stator 40A, the second annular stator 40B with respective masses MA1, MA2 and MB1, MB2 which independently transit therein. The first annular stator 40A and the second annular stator 40B include a multitude of electro-magnets 52A, 52B arranged around each respective stator 40A, 40B. It should be understood that many different magnet configurations are possible, for example, a continuous iron portion with wire wound slots powered by the amplifier 34A. The multitude of electro-magnets 52A, 52B receive power from the amplifier 34A in response to the control system 34 to independently drive the masses MA1, MA2, MB1, MB2. Masses MA1, MA2 in this non-limiting embodiment operate to suppress 5P vibration such that for a rotor system 12 which operates at 1P of 4.3 Hz, the masses MA1, MA2 transit the first annular stator 40A at 21.5 Hz in a rotational direction opposite that of the main rotor system 12. Masses MB1, MB2 in this non-limiting embodiment operate to suppress 3P vibration such that for a rotor system 12 which operates at 1P of 4.3 Hz, the masses MB1, MB2 transit the second annular stator 40B at 12.9 Hz in a rotational direction the same as that of the main rotor system 12. It should be understood that this non-limiting embodiment is for a four-bladed main rotor system 12 and that other main rotor systems 12 as well as other rotational systems will also benefit therefrom.\n\nAs the first and second annular stator  40A, 40B are mounted to the main rotor system 12 for rotation therewith, the masses MA1, MA2, MB1, MB2 need only be driven at five revolutions per cycle of the rotor system (for masses MA1, MA2) and at three revolutions per cycle in the opposite direction (for masses MB1, MB2) to achieve the desired 4P frequency. That is, since the masses MA1, MA2, MB1, MB2 are, in the rotating reference system of the main rotor system 12 which rotates at one revolution per cycle (1P), the masses MA1, MA2, MB1, MB2 need only augment the rotational speed by the difference (3P+1P) to achieve the necessary 4P in the stationary reference system for masses MB1, MB2 which rotate in the direction of the rotor system 12 and 5P?1P to achieve the necessary 4P in the stationary reference system for masses MA1, MA2 which rotate in a direction opposite of the rotor system 12.\n\nThe first annular stator  40A and the second annular stator 40B are generally of a channel shape in cross-section (FIG. 3B) such that the respective masses MA1, MA2 and MB1, MB2 are guided therein as well as are retained therein when the electro-magnets 52A, 52B are unpowered. That is, the first annular stator 40A and the second annular stator 40B are shaped to retain the masses MA1, MA2, MB1, MB2 when centrifugal force is unavailable.\n\nAlthough only a single mass (e.g., mass MA 1) will be described in detail herein, it should be understood that each of the masses MA1, MA2, MB1, MB2 may be generally alike in configuration. Furthermore, each of the masses MA1, MA2 and MB1, MB2 provide the desired xP suppression by providing a particular mass\x97here the masses MA1, MA2 may weigh approximately one pound (1 lb.), while the masses MB1, MB2 may weigh approximately two and one half pounds (2.5 lbs.) for stators 40A, 40B with a radius of approximately one foot. It should be understood that these dimensions are for example only and various arrangements may be provided in accordance with the present disclosure.\n\nReferring to  FIG. 3C, each of the masses MA1, MA2, MB1, MB2 in this non-limiting embodiment generally include a first wheel 54, a second wheel 56, a truck 58 which supports the wheels 54, 56 and a conductor 60 (FIG. 3C). The conductor 60 may be poles (permanent magnets) for a brushless electric motor embodiment or a conductive element for an inductive motor embodiment. Bearings 62 or the like may be utilized to support the wheels 54, 56 on the truck 58. Each truck 58 represents an independent secondary analogous to the moving part of a linear electric motor.\n\nThe truck  58 and/or the conductor 60 may provide the majority of the mass to provide the required anti-vibration forces. Furthermore, either or both of the wheels 54, 56 may be utilized to carry the majority of the mass. For the non-limited embodiment where low bearing loads in the truck 58 are desired, either or both of the wheels 54, 56 may operate as the conductor, i.e. no separate conductive plate type conductor 60 need be provided on the truck 58. The other wheel 56, 54 may thereby carry the majority of the mass. That is, one wheel 54 is relatively light in weight and conductive to provide propulsion, while the other wheel 56 of the same truck 58 is heavy in weight to define the eccentric mass.\n\nReferring to  FIG. 4A, each of the masses MA1, MA2, MB1, MB2 in this non-limiting embodiment includes a first wheel 80, a second wheel 82 and a truck 84 which supports the wheels 80, 82 with a radial-oriented conductor 86 (FIG. 4B) formed in part by the truck 84. At least a portion of the truck 84 forms the conductor 86 which is acted upon by a stator 88. Each stator 88 represents a primary analogous to a fixed portion of a linear electric motor. The stator 88 in this non-limiting embodiment is a wire wound slotted and laminated iron component.\n\nEach of the masses MA 1, MA2, MB1, MB2 represents the independent secondary analogous to the moving part of a linear electric motor. The conductor 86 may be manufactured of a conductive material such as copper or aluminum. In this non-limiting embodiment, the conductor 86 is oriented to be in-plane with the plane formed by the primary stator 88 such that the wheels 80, 82 need not provide propulsion. The wheels 80, 82 ride within an outer guide ring 90 (see FIGS. 4B and 4C). The truck 84 may form and/or include a relatively significant mass M between the wheels 80, 82 (FIG. 4C).\n\nReferring to  FIG. 5A, each of the masses MA1, MA2, MB1, MB2 in this non-limiting embodiment are supported within an annular bearing 100A, 100B formed within an outer bearing support 102. Each of the masses MA1, MA2, MB1, MB2 in this non-limiting embodiment includes a radial-oriented conductor 104A, 104B formed in part by a truck 106A, 106B. At least a portion of the truck 106A, 106B forms the conductor 104A, 104B which is acted upon by a stator 110 which represents the primary analogous to a fixed portion of a linear electric motor.\n\nEach truck  106A, 106B may form a relatively significant eccentric mass M which is supported adjacent the annular bearing 100A, 100B (FIG. 5B). That is, each truck 106A, 106B forms an eccentric mass M which rides within the annular bearing 100A, 100B.\n\nAlternatively, each truck  106A?, 106B? forms an eccentric mass M which is arranged between the annular bearing 100A, 100B (FIG. 5C). This arrangement locates the eccentric mass M in a more radial outboard position which facilitates a lighter weight mass for an equivalent diameter annular bearing 100A, 100B.\n\nReferring to  FIG. 6A, the two individual masses MA1, MA2 located on the first annular stator 40A and the two individual masses MB1, MB2 located on the second annular stator 40B (not shown) are independent controlled through primary sector power transmission. The sixty degree (60°)primary sectors in FIGS. 6A-6E facilitate the minimization of electronic components required to independently control the motion of each of the masses MA1, MA2 and MB1, MB2. Although only the first annular stator 40A with masses MA1, MA2 will be described in the examples herein, it should be understood that each of the two individual masses MB1, MB2 located on the second annular stator 40B\x97or additional annular stators\x97are generally alike in configuration and operation.\n\nThe primary sectors are independently commanded when only one mass MA 1, MB1 overlap that primary sector. In this way, one secondary mass MA1 is driven relative to the other mass MA2.\n\nIn the examples illustrated in  FIGS. 6A-6E masses MA1, MA2 are close together; thus a large anti-vibration force is produced. At this instant the primary sector 1 propels mass MA2 and the primary sector 6 propels mass MA2 thus independently regulating the velocities of masses MA1, MA2. As the two masses MA1, MA2 move clockwise, their dimension precludes both masses MA1, MA2 from occupying the same primary sector at the same time. Notice on subsequent Figures, that MAR2 departs sector 2 before MA1 enters sector 2. This permits independent control of the motions of masses MA1, MA2. Notice that MA1 and MA2 can of any dimension since the positions of masses MA1, MA2 may be tracked with a sensor system and can not be entirely within the same primary sector at the same time.\n\nAs the masses MA 1, MA2 move around the first annular stator 40A, the primary sectors which are at the same azimuth as the respective masses MA1, MA2 are selectively powered to control the respective masses MA1, MA2.\n\nOn occasion one of the masses MA 1, MA2 may abridge two primary sectors (FIGS. 6B-6E) such that two primary sectors are powered and commanded to control the motion.\n\nReferring to  FIG. 7A, each of the masses MA1, MA2, MB1, MB2 in this non-limiting embodiment generally include an independent wheel 64 in which the wheel 64 itself operates as the mass and the conducting secondary with no truck whatsoever. This eliminates the need for bearings. Each wheel 64 may travel within an outer guide ring 66 and an inner guide ring 68 which define a respective groove 66?, 68?. The inner guide ring 68 may be formed of electromagnets 70 which both power each wheel 64 as well as restrains each wheel 64 when not powered. It should be understood that other electro-magnet system arrangement may alternatively or additionally be utilized, e.g., the electro-magnet guide ring 70A may be the outer ring 66A (FIG. 7B).\n\nIn operation, the masses MB 1, MB2 (FIGS. 8A-8C) are propelled by the electro-magnets 52A within the annular stator 40B at a rotational speed greater than the rotational speed of the main rotor system 12 and appropriately positioned to yield a load vector P1 which is equal and opposite to the load vector R1 produced by the main rotor system 12. This counteracting load vector P1 may be interpreted as a vector which attempts to cancel or null the displacement of the main rotor system 12 and rotor shaft 24.\n\nFIGS. 8A-8C  depict various operating positions of masses MB1, MB2. Masses MA1, MA2 operate in an analogous manner which therefore need not be described in further detail. The vibration suppressor system 30 controls the rotational speed of the masses MA1, MA2, MB1, MB2 to produce a counteracting load of the correct magnitude and phase to suppress vibrations.\n\nReferring to  FIG. 8A, the masses MB1, MB2 are essentially adjacent and act in unison to produce a maximum force vector P1MAX. It should be understood that bumpers or such like may be provided to minimize impact between each mass MB 1, MB2, which may occur during some operational conditions.\n\nReferring to  FIG. 8B, the masses MB1, MB2 define a right angle (90 degrees) therebetween thereby producing a force vector P1MAX/(sqrt(2)) that is a fraction of the magnitude of the maximum force vector.\n\nReferring to  FIG. 8C, the masses MB1, MB2 are directly opposite (180 degree separation) and are essentially opposing to cancel the vectors produced by each of the masses MB1, MB2 such that essentially zero net force is generated at P1MIN.\n\nThe ability to independently vary the relative angular position of the masses is especially valuable in applications wherein the magnitude of the vibratory load active in/on the rotating system varies as a function of operating regime or operating speed. In a rotary-wing aircraft, for example, it is common to require the highest levels of vibration isolation in high speed forward flight i.e., where the rotor blades are experiencing the largest differential in aerodynamic loading from advancing to retreating sides of the rotor system. Consequently, it may be expected that the vibration suppressor system  30 produce the maximum load vector P1MAX (FIG. 8A). In yet another example, it is anticipated that the lowest levels of vibration isolation would occur in a loiter or hovering operating mode, where the rotor blades are exposed to the generally equivalent aerodynamic and gyroscopic affects. Consequently, it may be expected that the vibration suppressor system 30 a minimal load vector P1MIN (FIG. 8C).\n\nIt should be understood that relative positional terms such as \x93forward,\x94 \x93aft,\x94 \x93upper,\x94 \x93lower,\x94 \x93above,\x94 \x93below,\x94 and the like are with reference to the normal operational attitude of the vehicle and should not be considered otherwise limiting. \n\nAlthough particular step sequences are shown, described, and claimed, it should be understood that steps may be performed in any order, separated or combined unless otherwise indicated and will still benefit from the present disclosure. \n\nThe foregoing description is exemplary rather than defined by the limitations within. Many modifications and variations of the present disclosure are possible in light of the above teachings. The disclosed embodiments of this disclosure have been disclosed, however, one of ordinary skill in the art would recognize that certain modifications would come within the scope of this disclosure. It is, therefore, to be understood that within the scope of the appended claims, the disclosure may be practiced otherwise than as specifically described. For that reason the following claims should be studied to determine the true scope and content of this disclosure."
 'This application is a Continuation of Ser. No. 11/202,741, filed 11 Aug. 2005 in the United States, which is a Continuation of Ser. No. 10/306,865, now issued as U.S. Pat. No. 7,011,818, filed 27 Nov. 2002 in the United States, which is a Continuation of Ser. No. 09/680,863, now issued as U.S. Pat. No. 6,521,260, filed 6 Oct. 2000 in the United States which is a Continuation of Ser. No. 08/875,391, now issued as U.S. Pat. No. 6,153,224, filed 25 Sep. 1997 in the United States which is a National Stage of PCT/GB96/00215, filed 31 Jan. 1996 which claims benefit of United Kingdom application no. 9521937.4 filed 26 Oct. 1995 and United Kingdom application no. 9501841.2 filed 31 Jan. 1995 and which applications are incorporated herein by reference. To the extent appropriate, a claim of priority is made to each of the above disclosed applications. \n\nEmbodiments of the invention will now be described by way of example with reference to the accompanying drawings, of which: \n\nFIG. 1  shows a section through a carrier particle including additive particles on its surfaces;\n\nFIG. 2  is a perspective view of a dry powder inhaler;\n\nFIG. 3  is a sectional diagram of a twin stage impinger; and\n\nFIGS. 4 a & 4b show the effect of a milling treatment on the carrier particle of FIG. 1.\n\nThis invention relates to carrier particles for use in dry powder inhalers. More particularly the invention relates to a method of producing such particles, to a dry powder incorporating the particles and to the particles themselves. \n\nInhalers are well known devices for administering pharmaceutical products to the respiratory tract by inhalation. Inhalers are widely used particularly in the treatment of diseases of the respiratory tract. \n\nThere are a number of types of inhaler currently available. The most widely used type is a pressurised metered dose inhaler (MDI) which uses a propellant to expel droplets containing the pharmaceutical product to the respiratory tract. Those devices are disadvantageous on environmental grounds as they often use CFC propellants, and on clinical grounds related to the inhalation characteristics of the devices. \n\nAn alternative device to the MDI is the dry powder inhaler. The delivery of dry powder particles of pharmaceutical products to the respiratory tract presents certain problems. The inhaler should deliver the maximum possible proportion of the active particles expelled to the lungs, including a significant proportion to the lower lung, preferably at the low inhalation capabilities to which some patients, especially asthmatics, are limited. It has been found, however, that, when currently available dry powder inhaler devices are used, in many cases only about 10% of the active particles that leave the device on inhalation are deposited in the lower lung. More efficient dry powder inhalers would give clinical benefits. \n\nThe type of dry powder inhaler used is of significant importance to the efficiency of delivery over a range of airflow conditions of the active particles to the respiratory tract. Also, the physical properties of the active particles used affect both the efficiency and reproducibility of delivery of the active particles and the site of deposition in the respiratory tract. \n\nOn exit from the inhaler device, the active particles should form a physically and chemically stable aerocolloid which remains in suspension until it reaches a conducting bronchiole or smaller branching of the pulmonary tree or other absorption site preferably in the lower lung. Once at the absorption site, the active particle should be capable of efficient collection by the pulmonary mucosa with no active particles being exhaled from the absorption site. \n\nThe size of the active particles is important. For effective delivery of active particles deep into the lungs, the active particles should be small, with an equivalent aerodynamic diameter substantially in the range of 0.1 to 5 ?m, approximately spherical and monodispersed in the respiratory tract. Small particles are, however, thermodynamically unstable due to their high surface area to volume ratio, which provides significant excess surface free energy and encourages particles to agglomerate. In the inhaler, agglomeration of small particles and adherence of particles to the walls of the inhaler are problems that result in the active particles leaving the inhaler as large agglomerates or being unable to leave the inhaler and remaining adhered to the interior of the inhaler. \n\nThe uncertainty as to the extent of agglomeration of the particles between each actuation of the inhaler and also between different inhalers and different batches of particles, leads to poor dose reproducibility. It has been found that powders are reproducibly fluidisable, and therefore reliably removable from an inhaler device, when the particles have a diameter greater than 90 ?m. \n\nTo give the most effective dry powder aerosol, therefore, the particles should be large while in the inhaler, but small when in the respiratory tract. \n\nIn an attempt to achieve that situation, one type of dry powder for use in dry powder inhalers may include carrier particles to which the fine active particles adhere whilst in the inhaler device, but which are dispersed from the surfaces of the carrier particles on inhalation into the respiratory tract to give a fine suspension. The carrier particles are often large particles greater than 90 ?m in diameter to give good flow properties as indicated above. Small particles with a diameter of less than 10 ?m may be deposited on the wall of the delivery device and have poor flow and entrainment properties leading to poor dose uniformity. \n\nThe increased efficiency of redispersion of the fine active particles from the agglomerates or from the surfaces of carrier particles during inhalation is regarded as a critical step in improving the efficiency of the dry powder inhalers. \n\nIt is known that the surface properties of a carrier particle are important. The shape and texture of the carrier particle should be such as to give sufficient adhesion force to hold the active particles to the surface of the carrier particle during fabrication of the dry powder and in the delivery device before use, but that force of adhesion should be low enough to allow the dispersion of the active particles in the respiratory tract. \n\nIn order to reduce the force of adhesion between carrier particles and active particles, it has been proposed to add a ternary component. In particular, using carrier particles of lactose and active particles of salbutamol, it has been proposed to add particles of magnesium stearate or Aerosil 200 (trade name of Degussa for colloidal silicon dioxide) in an amount of 1.5% by weight based on the weight of the carrier particles to a lactose-salbutamol mix. \n\nThe conclusion of that proposal, however, was that, although the adhesion between the carrier particles and the active particles was reduced by the presence of the additive particles, the addition of the additive particles was undesirable. \n\nIt is an object of the invention to provide a method for producing carrier particles and a powder for use in dry powder inhalers, and to provide carrier particles and a powder that mitigates the problems referred to above. \n\nWe have found that, contrary to the teaching of the prior art referred to above, the presence of additive particles which are attached to the surfaces of the carrier particles to promote the release of the active particles from the carrier particles is advantageous provided that the additive particles are not added in such a quantity that the active particles segregate from the surfaces of the carrier particles during fabrication of the dry powder and in the delivery device before use. Furthermore, we have found that the required amount of the additive particles is surprisingly small and that, if a greater amount is added, there will be no additional benefit in terms of inhalation performance but it will adversely affect the ability to process the mix. The required amount of additive particles varies according to the composition of the particles\x97in the case where the additive particles are of magnesium stearate (that being a material that may be used but is not preferred), we have found that an amount of 1.5 percent by weight based on the total weight of the powder is too great and causes premature segregation of the active particles from the carrier particles. We believe that the same considerations apply in the case of Aerosil 200. \n\nThe present invention provides a powder for use in a dry powder inhaler, the powder including active particles and carrier particles for carrying the active particles, the powder further including additive material on the surfaces of the carrier particles to promote the release of the active particles from the carrier particles on actuation of the inhaler, the powder being such that the active particles are not liable to be released from the carrier particles before actuation of the inhaler. \n\n\x93Actuation of the inhaler\x94 refers to the process during which a dose of the powder is removed from its rest position in the inhaler, usually by a patient inhaling. That step takes place after the powder has been loaded into the inhaler ready for use. \n\nIn this specification we give many examples of powders for which the amount of the additive material is so small that the active particles are not liable to be released from the carrier particles before actuation of the inhaler but are released during use of the inhaler. If it is desired to test whether or not the active particles of a powder are liable to be released from the carrier particles before actuation of the inhaler a test can be carried out. A suitable test is described at the end of this specification; a powder whose post-vibration homogeneity measured as a percentage coefficient of variation, after being subjected to the described test, is less than about 5% can be regarded as acceptable. In an example of the invention described below the coefficient is about 2% which is excellent, whereas in an example also described below and employing 1.5% by weight of magnesium stearate the coefficient is about 15% which is unacceptable. \n\nThe surface of a carrier particle is not usually smooth but has asperities and clefts in its surface. The site of an asperity or of a cleft is believed to be an area of high surface energy. The active particles are preferentially attracted to and adhere most strongly to those high energy sites causing uneven and reduced deposition of the active particles on the carrier surface. If an active particle adheres to a high energy site, it is subjected to a greater adhesion force than a particle at a lower energy site on the carrier particle and will therefore be less likely to be able to leave the surface of the carrier particle on actuation of the inhaler and be dispersed in the respiratory tract. It would therefore be highly advantageous to decrease the number of those high energy sites available to the active particles. \n\nAdditive material is attracted to and adheres to the high energy sites on the surfaces of the carrier particles. On introduction of the active particles, many of the high energy sites are now occupied, and the active particles therefore occupy the lower energy sites on the surfaces of the carrier particles. That results in the easier and more efficient release of the active particles in the airstream created on inhalation, thereby giving increased deposition of the active particles in the lungs. \n\nHowever, as indicated above, it has been found that the addition of more than a small amount of additive material is disadvantageous because of the adverse effect on the ability to process the mix during commercial manufacture. \n\nIt is also advantageous for as little as possible of the additive material to reach the lungs on inhalation of the powder. Although the additive material will most advantageously be one that is safe to inhale into the lungs, it is still preferred that only a very small proportion, if any, of the additive material reaches the lung, in particular the lower lung. The considerations that apply when selecting the additive material and other features of the powder are therefore different from the considerations when a third component is added to carrier and active material for certain other reasons, for example to improve absorption of the active material in the lung, in which case it would of course be advantageous for as much as possible of the additive material in the powder to reach the lung. \n\nIn the present case, as indicated above, there will be an optimum amount of additive material, which amount will depend on the chemical composition and other properties of the additive material. However, it is thought that for most additives the amount of additive material in the powder should be not more than 10%, more advantageously not more than 5%, preferably not more than 4% and for most materials will be not more than 2% or less by weight based on the weight of the powder. In certain Examples described below the amount is about 1%. \n\nAdvantageously the additive material is an anti-adherent material and will tend to decrease the cohesion between the active particles and the carrier particles. \n\nAdvantageously the additive material is an anti-friction agent (glidant) and will give better flow of powder in the dry powder inhaler which will lead to better dose reproducibility from the inhaler. \n\nWhere reference is made to an anti-adherent material, or to an anti-friction agent, the reference is to include those materials which will tend to decrease the cohesion between the active particles and the carrier particles, or which will tend to improve the flow of powder in the inhaler, even though they may not usually be referred to as an anti-adherent material or an anti-friction agent. For example, leucine is an anti-adherent material as herein defined and is generally thought of as an anti-adherent material but lecithin is also an anti-adherent material as herein defined, even though it is not generally thought of as being anti-adherent, because it will tend to decrease the cohesion between the active particles and the carrier particles. \n\nThe carrier particles may be composed of any pharmacologically inert material or combination of materials which is acceptable for inhalation. Advantageously, the carrier particles are composed of one or more crystalline sugars; the carrier particles may be composed of one or more sugar alcohols or polyols. Preferably, the carrier particles are particles of lactose. \n\nAdvantageously, substantially all (by weight) of the carrier particles have a diameter which lies between 20 ?m and 1000 ?m, more preferably 50 ?m and 1000 ?m. Preferably, the diameter of substantially all (by weight) of the carrier particles is less than 355 ?m and lies between 20 ?m and 250 ?m. Preferably at least 90% by weight of the carrier particles have a diameter between from 60 ?m to 180 ?m. The relatively large diameter of the carrier particles improves the opportunity for other, smaller particles to become attached to the surfaces of the carrier particles and to provide good flow and entrainment characteristics and improved release of the active particles in the airways to increase deposition of the active particles in the lower lung. \n\nIt will be understood that, throughout, the diameter of the particles referred to is the aerodynamic diameter of the particles. \n\nAdvantageously, the additive material consists of physiologically acceptable material. As already indicated, it is preferable for only small amounts of additive material to reach the lower lung, and it is also highly preferable for the additive material to be a material which may be safely inhaled into the lower lung where it may be absorbed into the blood stream. That is especially important where the additive material is in the form of particles. \n\nThe additive material may include a combination of one or more materials. \n\nIt will be appreciated that the chemical composition of the additive material is of particular importance. \n\nPreferably the additive material is a naturally occurring animal or plant substance. \n\nAdvantageously the additive material includes one or more compounds selected from amino acids and derivatives thereof, and peptides and polypeptides having molecular weight from 0.25 to 1000 KDa, and derivatives thereof. Amino acids, peptides or polypeptides and their derivatives are both physiologically acceptable and give acceptable release of the active particles on inhalation. \n\nIt is particularly advantageous for the additive material to comprise an amino acid. Amino acids have been found to give, when present in low amounts in the powders as additive material, high respirable fraction of the active materials with little segregation of the powder and also with very little of the amino acid being transported into the lower lung. In respect of leucine, a preferred amino acid, it is found that, for example, for an average dose of powder only about 10 ?g of leucine would reach the lower lung. The additive material may comprise one or more of any of the following amino acids: leucine, isoleucine, lysine, valine, methionine, phenylalanine. The additive may be a salt or a derivative of an amino acid, for example aspartame or acesulfame K. Preferably the additive particles consist substantially of leucine, advantageously L-leucine. As indicated above, leucine has been found to give particularly efficient release of the active particles on inhalation. Whilst the L-form of the amino acids is used in Examples described below, the D- and DL-forms may also be used. \n\nThe additive material may include one or more water soluble substances. This helps absorption of the substance by the body if the additive reaches the lower lung. The additive material may include dipolar ions, which may consist of zwitterions. \n\nAlternatively, the additive material may comprise particles of a phospholipid or a derivative thereof. Lecithin has been found to be a good material for the additive material. \n\nThe additive material may include or consist of one or more surface active materials, in particular materials that are surface active in the solid state, which may be water soluble, for example lecithin, in particular soya lecithin, or substantially water insoluble, for example solid state fatty acids such as lauric acid, palmitic acid, stearic acid, erucic acid, behenic acid, or derivatives (such as esters and salts) thereof. Specific examples of such materials are: magnesium stearate; sodium stearyl fumarate; sodium stearyl lactylate; phospatidylcholines, phosphatidylglycerols and other examples of natural and synthetic lung surfactants; Liposomal formulations; lauric acid and its salts, for example, sodium lauryl sulphate, magnesium lauryl sulphate; triglycerides such as Dynsan 118 and Cutina HR; and sugar esters in general. \n\nOther possible additive materials include talc, titanium dioxide, aluminium dioxide, silicon dioxide and starch. \n\nAs indicated above, it is most important for the additive material to be added in a small amount. For example, magnesium stearate is highly surface active and should therefore be added in particularly small amounts; phosphatidylcholines and phosphatidylglycerols on the other hand are less active and can usefully be added in greater amounts; in respect of leucine, which is still less active, an addition of 2% by weight leucine based on the weight of the powder gives good results in respect of the respirable fraction of the active particles, low segregation and low amount of leucine reaching the lower lung; an addition of a greater amount does not improve the results and in particular does not significantly improve the respirable fraction and therefore whilst even with 6% leucine a reasonable result is obtained that is not preferred since it results in an increased quantity of additive material being taken into the body and will adversely affect the processing properties of the mix. \n\nThe additive material will often be added in particulate form but it may be added in liquid or solid form and for some materials, especially where it may not be easy to form particles of the material and/or where those particles should be especially small, it may be preferred to add the material in a liquid, for example as a suspension or a solution. Even then, however, the additive material of the finished powder may be in particulate form. An alternative possibility, however, that is within the scope of the invention is to use an additive material which remains liquid even in the final essentially particulate material which can still be described as a \x93dry powder\x94. \n\nIn some cases improved clinical benefits will be obtained where the additive material is not in the form of particles of material. In particular, the additive material is less likely to leave the surface of the carrier particle and be transported into the lower lung. \n\nWhere the additive material of the finished powder is particulate, the nature of the particles may be significant. The additive particles may be non-spherical in shape. In Examples 1 to 3 below, the additive particles are plate-like particles. Alternatively the additive particles may be angular for example prisms, or dendritic in shape. Additive particles which are non-spherical may be easier to remove from the surfaces of the carrier particles than spherical, non-angular particles and plate-like particles may give improved surface interaction and glidant action between the carrier particles. \n\nThe surface area of the additive particles is also thought to be important. The surface area of the additive particles, as measured using gas absorption techniques, is preferably at least 5 m 2g?1. In many cases it is found that additive material comprising small plate-like particles is preferred.\n\nAdvantageously, at least 95% by weight of the additive particles have a diameter less than 150 ?m, more advantageously less than 100 ?m, preferably less than 50 ?m. Preferably, the mass median diameter of the additive particles is not more than about 10 ?m. The additive particles preferably have a mass median diameter less than the mass median diameter of the carrier particles and will usually have a mass median diameter of approximately between a tenth and a hundredth that of the carrier particles. The diameter of the particles may be calculated by laser diffraction or by another method by which the aerodynamic diameter of the particles can be determined. \n\nThe ratio in which the carrier particles, additive material and active particles are mixed will, of course, depend on the type of inhaler device used, the type of active particles used and the required dose. As indicated above, the amount of additive material is of particular importance. Advantageously the amount is in the range of from 0.1 to 10% by weight of the additive material based on the weight of the carrier particles. For the examples given below, the powder preferably consists of not less than 0.1% by weight of additive material based on the weight of the carrier particles and the powder preferably consists of at least 0.1% by weight of active particles based on the weight of the powder. Furthermore, the carrier particles are preferably present in an amount of at least 90%, more preferably at least 95%, by weight based on the weight of the powder. \n\nConventional calculations of the extent of surface coverage of the carrier particles by the additive material shows that for the preferred carrier particles and preferred additive materials mixed in their preferred amounts, the amount of additive material is much more than that necessary to provide a monolayer coating of the carrier particle. For example, in the case of Example 1 described below, calculation shows that a small fraction of a percent of leucine by weight is sufficient to provide a monolayer coating, whereas 1% leucine by weight is employed. Furthermore, it is found that even with 1% leucine there is no \x93coating\x94 of the carrier particles in the sense in which that word is normally used in the art, namely to refer to a continuous envelope around the carrier particle; rather inspection of the carrier particles under an electron microscope shows much of the surface of each lactose particle remaining exposed with leucine particles covering only limited portions of each lactose particle and forming a discontinuous covering on each lactose particle. It is believed that the presence of such a discontinuous covering, as opposed to a \x93coating\x94 is an important and advantageous feature of the present invention. \n\nPreferably the additive material, whilst providing only a discontinuous covering for the carrier particles, does saturate the surfaces of the carrier particles in the sense that even if more additive material were provided substantially the same covering of the carrier particles would be achieved. When the additive material in the finished powder is particulate, some of the additive particles, either individually or as agglomerates, may act as carriers of active particles and may be separate from or may separate from the surfaces of the carrier particles with active particles attached to their surfaces. The dimensions of the combined active particle and additive particle may still be within the optimum values for good deposition in the lower lung. It is believed that active particles which adhere to the additive particles on the carrier particles may in some cases be preferentially released from the surfaces of the carrier particles and thereafter be deposited in the lower lung without the additive particles. \n\nAdvantageously, the mass median diameter of the active particles is not more than 10 ?m, preferably not more than 5 ?m. The particles therefore give a good suspension on redispersion from the carrier particles and are delivered deep into the respiratory tract. Where the active particles are not spherical, the diameter of the particles may be calculated by laser diffraction or another method by which the aerodynamic diameter of the particles can be determined. \n\nThe active material referred to throughout the specification will be material of one or a mixture of pharmaceutical product(s). It will be understood that the term \x93active material\x94 includes material which is biologically active, in the sense that it is able to increase or decrease the rate of a process in a biological environment. The pharmaceutical products include those products which are usually administered orally by inhalation for the treatment of disease such as respiratory disease eg. ?-agonists, salbutamol and its salts, salmeterol and its salts. Other pharmaceutical products which could be administered using a dry powder inhaler include peptides and polypeptides, such as DNase, leucotrienes and insulin. \n\nThe active particles may include a ? 2-agonist which may be terbutaline, a salt of terbutaline, for example terbutaline sulphate, or a combination thereof or may be salbutamol, a salt of salbutamol or a combination thereof. Salbutamol and its salts are widely used in the treatment of respiratory disease. The active particles may be particles of salbutamol sulphate. The active particles may be particles of ipatropium bromide.\n\nThe active particles may include a steroid, which may be beclomethasone dipropionate or may be Fluticasone. The active principle may include a cromone which may be sodium cromoglycate or nedocromil. The active principle may include a leukotriene receptor antagonist. \n\nThe active particles may include a carbohydrate, for example heparin. \n\nAccording to the invention, there are provided particles for use in a powder as described above, the particles including carrier particles of a first composition and of a size suitable for use in a dry powder inhaler and additive material of a second composition, the additive material being attached to the surfaces of the carrier particles. \n\nIn a general aspect, the invention also provides a powder for use in a dry powder inhaler, the powder including active particles and carrier particles for carrying the active particles wherein the powder further includes additive material which is attached to the surfaces of the carrier particles to promote the release of the active particles from the carrier particles. \n\nAccording to the invention, there is also provided a method of producing particles suitable for use as particles in dry powder inhalers, the method including the step of mixing carrier particles of a size suitable for use in dry powder inhalers with additive material which becomes attached to the surfaces of the carrier particles. \n\nAdditive material, which may be in liquid form or may comprise additive particles, or agglomerates of additive particles, may be introduced to a sample of carrier particles, which may have been treated as described below, and the mixture blended to allow the additive material to become attached to the surfaces of the carrier particles. \n\nAs indicated above, the exact ratio in which the carrier particles and the additive particles are mixed will, of course, depend on the type of device and the type of active particles used. Also as indicated above, the proportion of the additive material in the powder is of particular importance. \n\nThe size of the carrier particles is an important factor in the efficiency of the inhaler, and an optimum, or near optimum, range of size of particles is preferably selected. Therefore, the method advantageously further includes the step of selecting from a sample of carrier particles an advantageous range of size of carrier particles prior to the mixing step and, in the case where the additive material is in the form of particles when it is mixed with the carrier particles, preferably also includes the step of selecting from a sample of additive particles an advantageous range of size of additive particles prior to the mixing step. The step of selecting an advantageous range of size may be a sieving step. \n\nAdvantageously the additive material and the carrier particles are mixed for between 0.1 hours and 0.5 hours. The particles may be mixed using a tumbling blender (for example a Turbula Mixer). \n\nAdvantageously, the method further includes the step of treating the carrier particles to dislodge small grains from the surfaces of the carrier particles, without substantially changing the size of the carrier particles during the treatment. \n\nAs indicated above, the surface of a carrier particle is not usually smooth but has asperities and clefts in the surface. As a result, the surfaces have areas of high surface energy to which active particles are preferentially attached. An active particle at a high energy site is less likely to be able to leave the surface and be dispersed in the respiratory tract than an active particle at a site of lower surface energy. During the treatment referred to immediately above, asperities are removed as small grains, thus removing active sites associated with the asperities. \n\nAdvantageously, the mixing step is prior to the treatment step. The additive material may therefore be added in the form of large particles which are broken into smaller particles during the treatment. Alternatively the treatment may be carried out before the addition of the additive material or, alternatively, after the addition of the additive material and of the active particles. \n\nAdvantageously, the small...'
 ...
 "CROSS REFERENCE TO RELATED APPLICATIONS \n\nThis is a divisional of U.S. application Ser. No. 10/492,802, filed Oct. 22, 2004, now U.S. Pat. No. 7,572,633, which is 371 application of International Patent Application No. PCT/EP02/11527, filed Oct. 15, 2002, which claims priority to DE 10150984.7 filed on Oct. 16, 2001, the contents each of which are fully incorporated herein by reference. \n\nThe invention will be illustrated in the following by the figures, examples and sequence listing from which further features, embodiments and advantages of the invention can be derived. In these \n\nFIG. 1  shows fluorescence microscopic images of U2OS cells which have been transfected with a vector encoding green fluorescent protein subject to the control of the CMV promoter (FIGS. 1A, 1B), the control of the E2 late promoter (FIGS. 1C, 1D) and the control of an E2 late promoter mutating in the YB-1 box (FIGS. 1E, 1F) following the infection with an E1/E3 deleted adenovirus (FIGS. 1A, 1C, 1E) and a YB-1 expressing E1/E3-deleting adenovirus (FIGS. 1B, 1D. 1F) and\n\nFIG. 2  shows fluorescence microscopic images of YB-1 nucleus-negative U2OS cells (FIG. 2A) and YB-1-nucleus-positive cells (FIG. 2B) following transfection with a plasmid encoding green fluorescent protein subject to the control of the adenoviral E2 late promoter.\n\nEXAMPLES \n\nExample 1 \n\nThe E2 Late Promoter is YB-1 Specific \n\nThe E2 late promoter was cloned in the vector pGL3 enhancer (Promega) into the XhoI and HindIII interface. This vector possesses the luciferase gene or, alternatively, the GFP gene as reporter gene. As soon as GFP is expressed, the cells light up green. Firstly, 200,000 U2OS cells per well were presented in the plate of 6 such wells. After 24 hours, the transfection of the different vectors containing the different fragments of the E2 late promoter was effected by Superfect in line with the manufacture's instructions (Qiagen). The plasmids were produced from the pGL3 enhancer vector, Promega, the luciferase gene being replaced by the reporter gene GFP (green fluorescent protein). \n\nAfter a further 24 hours, the cells were infected with 50 pfu/cell using a E1/E3-deleted adenovirus (AdlacZ, left hand column of  FIG. 1) and AdYB-1 (right hand column of FIG. 1). AdYB-1 is an E1/E3 deleted adenovirus which expresses the transcription factor YB-1 as a transgene. After a further 24 hours, the evaluation took place under a fluorescence microscope. The result clearly shows that only the intact E2 late promoter is activated by the expression of YB-1 as illustrated in FIG. 1D. The cells illustrated in FIGS. 1A and 1B were transfected as positive controls using plasmid constructs in the case of which the green fluorescent protein was subjected to the control of the cytomegalovirus promoter (CMV). In the case of the constructs or tests illustrated in FIGS. 1C and 1D, the E2 late promoter was used according to the invention, i.e. the expression of the green fluorescent protein was subjected to the control of this promoter. In the case of the cells illustrated in FIGS. 1E and 1F, a mutated E2 late promoter of adenovirus was used instead of the E2 late promoter of adenovirus. The mutation was situated in the YB-1 box, the sequence GCCTG instead of ATTGG being used.\n\nExample 2 \n\nThe E2 Late Promoter is Specific for YB-1 Nucleus-Positive Cells \n\nFor the investigation of the specificity of the E2 late promoter in resistant YB-1 nucleus-positive cells, the following experiment was carried out. \n\n2,000,000 cells per well were presented in a plate of 6 wells. A synthesised E2 late promoter in pGL3 enhancer vector (obtainable from Promega) with the reporter gene GFP was transfected by Superfect from Qiagen in line with the manufacturer's instructions 24 hours later into the cells. After a further 48 hours, the evaluation took place under a fluorescence microscope. \n\nFIG. 2A  shows the result of the osteosarcoma cells U2OS which exhibit no YB-1 in the nucleus. In FIG. 2B, the result is illustrated using multi-drug resistant stomach carcinoma cells 257RDB. In the case of these cells, YB-1 is localised in the cell nucleus. The result clearly shows that the reporter gene GFP is activated via the E2 late promoter only in YB-1 nucleus-positive 257RDB cells.\n\nThe characteristic features of the invention disclosed in the above description, the claims and the drawings can be essential either individually or in any desired combination for effecting the invention in its various embodiments. \n\nREFERENCE TO THE SEQUENCE LISTING \n\nReference is made to the Sequence Listing submitted herewith consisting of a file named \x93SL.txt\x94 (1 KB, created Sep. 23, 2009), and the contents of which are incorporated herein by reference. \n\nThe present invention relates to the use of an adenoviral E2 late promoter, a nucleic acid construct comprising an adenoviral E2 late promoter, a vector comprising this nucleic acid construct and the use of the nucleic acid construct. \n\nNumerous therapy concepts are being followed up at present in the treatment of tumours. Apart from using surgical techniques, chemotherapy and radiotherapy are to the fore. However, all these techniques are associated with not inconsiderable side effects for the patient. \n\nBy using replication-selective oncolytic viruses, a new technological platform has been created for the treatment of tumours. In this case, a selective intratumour replication of a viral agent is brought about which subsequently leads to virus replication, lysis of the infected tumour cells and spreading of the virus to neighbouring tumour cells. As a result of the restriction, to tumour cells, of the ability of the virus to replicate, normal tissue is spared infection and consequently lysis by the virus. Examples of such replication selective oncolytic viruses are the gene attenuated adenovirus and Herpes viruses (Martuza, R. et al. Science 252, 854-858 (1991); Fueyo, J et al. Oncogene 19, 2-12 (2000)). \n\nAdenoviruses are well known in industry. They consist of dsDNA viruses (Boulanger, P et al. (1991); Biochem J. 275, 281-299). The complete nucleotide sequence of the adenoviral genome is known and has been described (Chroboczek, J. et al., Virology 1992, 186, 280-285). A part of the genome which is particularly important for the use of adenoviruses consists of the so-called early genes and their gene products referred to as E1, E2, E3 and E4. E1 comprises two gene products, namely E1A and E1B, which represent oncogenes. The gene products, three in total, of group E2 participate in the replication together with the gene products E3 and E4. \n\nAn example of an oncolytic adenovirus is dl 1520 (Onyx-015), which has already been successfully used in clinical phases I and II (Khuri, F. et al. Nature Medicine 6, 879-885 (2000). Onyx-015 is an adenovirus in the case of which the E1B 55 kDa gene has been deleted. The E1B 55 kDa gene product participates in the inhibition of p53, the transport of viral mRNA and the termination of protein synthesis of the host cell. In this case, the inhibition of p53 takes place by the formation of a complex from p53 and the adenovirus-encoded E1B kDa protein. P53, TP53 when encoded, effects complex regulatory mechanism (Zambetti, G. P. et al., FASEB J, 7, 855-865), which, among other things, leads to an efficient replication of viruses, such as adenoviruses, being suppressed in the cell. The gene TP53 is deleted or mutated in approximately 50% of all human tumours with the consequence that no\x97desirable\x97apoptosis occurs as a result of chemotherapy or radiotherapy and consequently the success of this tumour treatment fails to materialise in normal cases. \n\nDNA tumour viruses such as adenoviruses propel the infected cells into the S phase of the cell cycle in order to facilitate viral DNA replication. Onyx-015 does not express the E1B 55 kDa protein and replicates selectively in tumour cells compared with normal cells. In addition, there is a further selectivity with the effect that those tumours which are p53 deficient undergo a comparatively stronger necrosis as a result of the viral lysis of the tumour cells, than those exhibiting the p53 wild type (Khuri et al, compare above). In spite of the effectiveness of Onyx-015 in virus-induced oncolysis in the case of tumours deficient in p53 on principle, the success rate of 15% of the treated tumours is very low. Ries et al. (Ries, D. J. et al. Nature Medicine 6, 1128-1132 (2000)) have shown a basic possibility of how to successfully use Onyx-015 also for tumours with p53 wild type. In this case, the tumour suppressor protein p14ARF is not expressed. As a result of the absence of p14ARF, the normal reaction of the p53 system vis-à-vis a viral infection does not occur thus allowing the replication of Onyx-015 also in these tumours. However, the practical application of this knowledge presupposes that a suitable genetic background exists in the tumour cell or is provided by suitable therapeutic measures. In the former case, the number of tumours treatable by Onyx-015 would be further reduced, in the second case, a time consuming/complicated modification of the genetic background of the tumour cells would be required. \n\nIn one aspect, the problem underlying the present invention is to provide a promoter which allows a tumour-specific expression of nucleic acids. In another aspect, the invention is based on the objective of providing a medicament for the therapy of YB-1 positive diseases, in particular of tumour diseases. \n\nAccording to the invention, the objective is achieved in a first aspect by the use of an adenoviral E2 late promoter or a fragment thereof for the expression of genes which are different from the adenoviral genes or adenoviral nucleic acids controlled by the E2 late promoter in a naturally occurring adenovirus. \n\nIn a second aspect, the task according to the invention is achieved by the use of an adenoviral E2 late promoter or a fragment thereof for the expression of a transgene or a transgenic nucleic acid. \n\nIn one embodiment of the uses according to the invention, it is provided for the promoter fragment to comprise a sequence according to SEQ. ID. No. 1. \n\nIn an alternative embodiment of the uses according to the invention it is provided for the promoter fragment to exhibit a sequence according to SEQ. ID. No. 2. \n\nIn one embodiment of the uses according to the invention, it is provided for the promoter and/or the promoter fragment to exhibit a binding site for YB-1. \n\nIn a further embodiment of the uses according to the invention it is provided for the promoter and/or the fragment to exhibit at least one element selected from the group comprising the Y-box, the TATA box and the SPI binding site. \n\nIn an even further embodiment of the uses according to the invention it is provided for the promoter and/or the promoter fragment to exhibit YB-1 in the bound form. \n\nIn one embodiment of the uses according to the invention it is provided for the transgene and/or the adenoviral gene controlled by the E2 late promoter and/or the nucleic acid controlled by the E2 late promoter to be selected from the group of genes comprising apoptosis-inducing genes, genes for prodrug systems and genes for protease inhibitors. \n\nIn one embodiment of the uses according to the invention it is provided for the transgene or the adenoviral genes or nucleic acid(s) controlled by the adenoviral E2 late promoter to be selected from the group comprising antisense molecules, ribozymes and aptamers. \n\nIn a third aspect, the objective of the invention is achieved by a nucleic acid construct comprising an adenoviral E2 late promoter or a fragment thereof and a nucleic acid, the nucleic acid being selected from the group comprising transgenes, genes and nucleic acids which are respectively different from the adenoviral nucleic acids controlled by an E2 late promoter. \n\nIn one embodiment it is provided for the promoter fragment to comprise a nucleic acid sequence selected from the group comprising SEQ. ID. No. 1 and SEQ. ID. No. 2. \n\nIn a fourth aspect, the objective according to the invention is achieved by a vector comprising a nucleic acid construct according to the invention. \n\nIn a fifth aspect, the objective according to the invention is achieved by the use of a nucleic acid construct according to the invention for the preparation of a medicament. \n\nIn one embodiment it is provided for the medicament to be used for the treatment of tumours. \n\nIn a further embodiment it is provided for the tumours to be those exhibiting YB-1 in the nucleus. \n\nIn an even further embodiment it is provided for the tumours to be those exhibiting YB-1 in the nucleus, preferably exhibiting YB-1 in the nucleus in the presence of a stress factor. \n\nIn one embodiment it is provided for the stress factor to be selected from the group comprising hypothermia, UV exposure and exposure vis-à-vis cytostatics. \n\nIn an even further embodiment it is provided for the medicament to be used together with cytostatics and/or hypothermia. \n\nFinally, in an even further embodiment it is provided for the tumour to exhibit tumour cells with multi-drug resistances. \n\nThe present invention is based on the surprising finding that YB-1 in the nucleus binds to the adenoviral E2 late promoter and this promoter is highly suitable for the expression of nucleic acids which are different from those nucleic acids which are controlled in an adenoviral system, i.e. in a naturally occurring adenovirus, by the E2 late promoter. Moreover, it has surprisingly enough been found that the adenoviral E2 late promoter, on the one hand, is a very strong promoter and, compared with the CMV promoter used as gold standard, is only negligibly weaker in the presence of a practically non-existent background expression in the case that the promoter is not active. \n\nThe use, according to the invention, of the adenoviral E2 late promoter is determined in particular by its regulatibility by YB-1, YB-1 being effective as a positive effecter, i.e. the promoter is active only in the presence of YB-1 in the nucleus. In this respect, said adenoviral E2 late promoter can be regulated in a highly selective manner and is consequently usable in systems in which YB-1 is present in the nucleus and practically any expression of the nucleic acid being subject to the control of the adenoviral E2 late promoter is prevented in the case where YB-1 is not present in the nucleus as effecter or regulator. \n\nYB-1 is a representative of the Y box protein family which binds to the DNA sequence motive Y-box. The Y-box motive represents a transcriptionally regulatory element which is present in the promoter regions or enhancer regions of a number of different genes which play a part in the regulation of cell proliferation (Ladomery, M. et al. 1995; Bioassays 17: 9-11 Didier, D. K. et al, 1988, PNAS, 85, 7322-7326). \n\nThe details provided here apply also to fragments of the said adenoviral E2 late promoter which, herein, will also occasionally be referred to as E2 late promoter or later on as E2 promoter, and in particular to those promoter fragments disclosed herein and referred to as SEQ. ID. No. 1 and SEQ. ID. No. 2. \n\nThe nucleic acid sequence according to SEQ. ID. No. 1 is as follows: \n\n\n5??atttgtacctgaggactaccacgcccacgagattaggtt \n\nctacgaagac caatcccgcccgccaaatgcggagc- 3?\n\nThe Y box (CAAT) considered relevant for the binding of YB-1 is printed in bold. \n\nThe sequence according to SEQ. ID. No. 1 is the range of positions ?22 to ?96 of the E2 late promoter. \n\nThe nucleic acid sequence according the SEQ. ID. No. 2 is as follows: \n\n\n5??ccacgagattaggttctacgaagac caatcccgcccgccaa- 3?\n\nThe nucleic acid sequence according to SEQ. ID. No. 2 comprises the range of positions ?47 to ?87 of the E2 late promoter. \n\nIn addition, it is within the scope of the present invention that each fragment or derivative of the promoter can be used for as long as it is capable of binding YB-1 and still exhibits a promoter activity. Without wishing to be restricted thereto, binding of YB-1 appears to take place to the Y box or the Y box seems to participate in the formation of secondary structures as a result of which the presence of this box is significant for the formation of the adenoviral E2 late promoter and corresponding fragments used according to the invention. \n\nThe E2 late promoter of adenovirus has been described, for example, by Swaminathan, S., and Thimmapaya, B. (1995) Curr. Top. Microbiol. Immunol., 199, 177-194. In the adenoviral system, the E2 late promoter, together with the E2 early promoter, has the function of controlling the adenoviral E2 region and/or genes E2A and E2B. In this case, the synthesis of the E2 mRNA takes places initially starting out from the E2 early promoter. Approximately five to seven hours after the infection of a cell, a switch-over to the E2 later promoter takes place. The mechanism on which this process is based is not yet known at present. \n\nIn the early phase of infection with adenoviruses, two mRNA products of the E1A region are first produced, which products are 13S or 12S in size. Investigations have shown that the E1A 12S protein prevents and/or represses the activation of the E2 region via the E2 late promoter. The gene encoding for the E1A 13S protein, on the other hand, activates the E2 region and/or genes via the E2 early promoter (Guilfoyle R A, Osheroff W P, Rossini, EMBO J 1985, 4, 707-713). \n\nMoreover, it is known that a deletion of the region of the range of the nucleotides ?51 to ?33 of the E2 late promoter represses the synthesis of the E2 region almost completely (Guilfoyle R A et al, compare above). \n\nIt is within the scope of the present invention that it is possible for any adenoviral E2 late promoter to be used. Such different adenoviral E2 late promoters can be determined by the different forms of the adenoviruses such as they are known in the state of the art. At present, approximately 50 sub-types are known in the state of the art each of which could, in principle, be used within the scope of the present invention either as a vector or as source of an E2 late promoter. \n\nThe E2 late promoter exhibits a number of structural and sequential characteristics which may be significant for its use and in particular the use of fragments of the promoter. The formation of a loop in the range of the nucleotides of ?47 to ?81 is such a characteristic, position ?1 denoting directly the first nucleotide which is transcribed under the control of the promoter. This loop is an integral part of the two fragments, disclosed herein, of the E2 late promoter which also exhibit the properties described herein for the complete E2 late promoter. A second feature which is preferably contained in the functionally active fragments of the E2 late promoter is the so-called Y-box which appears to be responsible for binding of the YB-1 protein. Further elements which may form part of preferred embodiments of the E2 late promoter and the fragments according to the invention are the TATA box and SPI binding site. In this respect, the TATA box is important for the initiation of transcription and is usually situated at a distance of approximately 25 to 32 bp upstream of the transcription initiation site. A further feature of the E2 late promoter and/or of a functionally active fragment thereof, which may optionally be present either individually or as a complement to the other features described above, is the so-called SPI binding site. The SPI binding site is formed by the so-call GC box which binds to the transcription factor SPI. More than one GC box may be present per promoter. \n\nThe nucleic acid construct disclosed herein and/or the E2 late promoter or a functionally active fragment thereof can be present either in a form in which YB-1 is bound or in a YB-1-free form. If YB-1 is bound, the promoter is functionally active and a transcription may occur in a suitable transcription system; in the absence of YB-1, the promoter is not active so that no transcription can be observed in a transcription system. Suitable transcription systems have been described, for example, by Lewin, B., Gene: Lehrbuch der molekularen Genetik VCH Verlagsgesellschaft, 6490 Weinheim, Germany. \n\nAccording to the present invention, it is possible for practically any nucleic acid to be subjected to the control of the adenoviral E2 late promoter which then controls the expression of the nucleic acid. In this case, the E2 late promoter is subject to the stringent control of YB-1. Both genes and generally encoding sequences or fragments thereof can in this case be used as possible nucleic acids, but also non-encoding nucleic acids. In the case of the expression of nucleic acids encoding in the widest sense and their control by the E2 late promoter, it is anticipated that the requirements generally applying to promoters are satisfied, i.e. a suitable initiation codon exists and the promoter is positioned at a distance from the initiation codon such that a translation is possible. The same applies, in principle, also regarding the requirements existing for transcription. \n\nIn principle, it is within the scope of the present invention that any encoding nucleic acid can be used. With a view to the specific regulatibility of the promoter by YB-1 and consequently the use of the vector in a biological system characterised by the absence or presence of this effecter, preferred combinations of encoding sequences with the E2 late promoter are obtained. Since YB-1 is associated in particular with different tumour events, preferred nucleic acids may consist of those which may be important in the treatment of tumours at the molecular level. These include apoptosis inducing genes, for example. By introducing such genes into tumours cells exhibiting YB-1 in the nucleus (for example 30% of the ovarian carcinoma [Kamura et al., 1999; Cancer, 85, 2450-2454, Shibao K, Takano H, Nakayama Y, Okazaki K, Nagata N, Izumi H, Uchiumi T, Kuwano M, Kohno K, Itoh H Enhanced coexpression of YB-1 and DNA topoisomerase II alpha genes in human colorectal carcinomas. Int J Cancer 1999 Dec. 10; 83(6):732-7]), be it natural or induced, it is only the tumour cells which are capable of expressing the genes coupled to the promoter with the result that apoptosis caused by the apoptosis inducing gene takes place only in these cells. The situation is similar for other genes introduced in this way. Preferably, those genes are introduced which lead to a modification of the behaviour of the cells such as the tumour character of the cells and/or to selective killing of the tumour cells, for example. Apart from apoptosis genes, those genes can be introduced which interfere with the cellular events in a highly indirect manner, such as protease inhibitors, for example. Such protease inhibitors should, in general, inhibit the invasive behaviour and/or metastasis of the tumours. These include matrix metallo proteases (MMP), plasminogen activator systems (uPA), cathepsin. Moreover, the E2 late promoter can be used, according to the invention, for controlling the expression of viral proteins, viral proteins being those which normally, i.e. in the naturally occurring adenoviruses, are not subject to the control of E2 late promoter. In particular, they are the viral proteins E3ADP, E4orf6 and E1B55k. E4orf6 is a multifunctional protein which is required for maximum viral DNA replication and particle formation. It also plays an important part in splicing and the transportation of the viral RNA. In addition, it interacts with the viral protein E1B55k in order to accelerate the inactivation of p53. E1B55K, too, is a multifunctional protein which promotes, in interaction with the E4orf6 protein, the export of the viral RNA, whereas the cell-inherent RNAs are retained in the cell nucleus. A further important function of E1B55k consists of inactivating, either alone and/or together with E4orf6, the cellular protein p53. E3ADP, also referred to as adenoviral death protein, is an integral membrane glycoprotein which is required for an efficient cell lysis and the liberation of the newly synthesised viruses. The viral proteins mentioned above are known to the experts in this field and have been described in the literature. \n\nThe selective killing of the cells can take place either directly as a result of the influence of the genes introduced or indirectly as a result of the changes in the cells caused by the introduced genes. Such a change can, for example, lead to further compounds supplied from outside acting on the cells first and consequently leading to a killing of the tumour cells, for example. An example of this approach is provided by genes which need to be ascribed to the prodrug system. The prodrug system is a system in particular of enzymes which lead to metabolically non-active chemical compounds supplied to an organism as a medicine, for example, being converted into the pharmaceutically effective form only in the body. The thymidine kinase system (TK system), for example, is an example of a prodrug. It is based on the expression of the Herplex simplex thymidine kinase gene (HSVtk) following the addition of the prodrug ganciclovir. This is non-toxic to man in this form. Thymidine kinase phosphorylates the ganciclovir substrate. A purin analogue is formed which is toxic. A further example is provided by the cytosin desaminase gene system (CD). \n\nCoupling of the adenoviral E2 late promoter to a non-encoding nucleic acid is possible also to an rRNA or tRNA, for example. In this respect, an enhanced expression of this RNA population which is essential for the functioning of a cellular system is possible, which populations may in turn be associated with numerous cellular effects and functions. \n\nA further form of the non-encoding nucleic acids which may be subjected to the control of the adenoviral E2 late promoter are aptamers, ribozymes, antisense molecules and siRNA. Aptamers are nucleic acids, preferably ribonucleic acids which bind specifically to a target molecule vis-à-vis which they have been selected. The preparation of such aptamers has been described in European patent EP 0 533 838, for example. A further group of nucleic acids which can be subjected to the control of the adenoviral E2 late promoter consists of the antisense molecules whose principle of action is based on the fact that these molecules form a complex with mRNA and thus prevent the translation of the mRNA. In one embodiment, antisense molecules are also known in such a form that the cellular RNase H system is activated and, as a result of the enzymatic activity of the RNase H system, the mRNA complexed or hybridised with the antisense molecule is degraded. \n\nFinally, the non-encoding nucleic acid can also consist of ribozymes, i.e. nucleic acids which are catalytically active and capable of splitting, i.e. hydrolysing, either intramolecular or intermolecular nucleic acids, in particular ribonucleic acid. As a result of the sequence specificity of ribozymes, it is possible to selectively hydrolyse specific nucleic acid populations in a biological system, such as a cell, thus influencing biological processes. \n\nThe nucleic acid construct disclosed herein can be designed to the extent such as it has been described above for the different uses of the E2 late promoter and fragments thereof. \n\nThe nucleic acid construct can be present in different forms. It is thus within the scope of the present invention for the nucleic acid construct to be part of a vector. Such vectors are known to the persons skilled in the art and comprise plasmids and viruses, for example. Preferably, the vectors are those for eukaryotic cells, in particular for mammalian cells. Viral vectors comprise, among others, adenoviral vectors, retroviral vectors, adeno-associated vectors (AAV) and Herpes simplex vectors. All vectors have been mentioned and/or described by Dougherty, G J, Chaplin, D., Dougherty, S T., Chiu, R K, McBridge, Wh. In vivo gene therapy of cancer, Tumour Targeting, 2, 106-114 (1996); Advances in Pharmacology: Gene Therapy, Editor J. Thomas August, Volume 40, Academic Press. \n\nThe nucleic acid construct according to the invention can be used in general for the preparation of medicaments. In this respect, there are no restrictions regarding the type of indication for such medicaments for as long as the medicaments are characterised in that they are formed and/or become effective by using the adenoviral E2 late promoter or a functionally active fragment thereof as disclosed herein. In other words, medicaments according to the meaning of the present invention include those which consist of known genes or general nucleic acids provided these are subject to the control of the adenoviral late E2 promoter or a functionally active fragment thereof. \n\nA preferred indication regarding the use of the medicaments according to the invention is represented by tumour diseases. This is due to the binding of YB-1, disclosed herein, to the adenoviral E2 late promoter and the specific regulatibility of the promoter, which is based thereon, such that each nucleic acid which is subject to the control of the adenoviral E2 late promoter or a functionally active fragment thereof is specifically expressed in tumour cells exhibiting YB-1 in the nucleus. Normal, in particular human, cells possess YB-1 only in the cytoplasma such that these do not exhibit any expression of the nucleic acid which is subject to the control of the adenoviral E2 late promoter or a functionally active fragment thereof. \n\nAs a result of the coupling of the activation of the nucleic acid which is subject to the control of the adenoviral E2 late promoter or a functionally active fragment thereof with YB-1 present in the cell nucleus, it is possible to treat with the nucleic acid construct according to the invention also those diseases and in particular tumour diseases in the case of which YB-1 is present in the cell nucleus only if certain conditions exist which lead to the YB-1 being present in the nucleus exclusively, mainly or to an extent increased vis-à-vis the absence of the said specific conditions. Within the region of the tumour diseases, the localisation of YB-1 in the nucleus can be effected by the cells being exposed to stress factors. Such stress factors include, for example, hypothermia, UV radiation or the treatment of the cells or the organism containing these by cytostatics. Such cytostatics comprise cis-platinum, among others. \n\nFurther cells which are basically accessible to the treatment by the nucleic acid construct according to the invention are the so-called multi-drug resistant tumour cells. Multi-drug resistance is caused by the synthesis of P-glycoprotein. The connection between YB-1 and MDR-1 gene expression (MDR multiple drug resistance) has been described by Bagou et al. (Bagou, R. C. et al., Nature Med. 3, 1997, 4: 447-450). As a result of this connection, those tumour cells and tumours containing them which are P-glycoprotein positive can be addressed and treated by the nucleic acid construct according to the invention."
 "This application is a continuation of U.S. patent application Ser. No. 10/492,827, filed Jul. 15, 2004, and issuing Apr. 24, 2012, as U.S. Pat. No. 8,162,988, which is a National Stage entry of International Application No. PCT/IB02/04307, filed Oct. 18, 2002, which claims priority to French Patent Application No. 01/13460, filed Oct. 18, 2001, all of which are incorporated herein by reference. \n\nThe invention, with its characteristics and advantages, will be seen more clearly upon reading the description with reference to the appended figures wherein: \n\nFIGS. 1 a, 1b, and 1c represent an osteosynthesis device according to the invention in an embodiment comprising an \x93H\x94-shaped plate and two polyaxial head implants fitted on an interval vertebra, in three successive phases of the fitting of the plate in the implants;\n\nFIG. 2  represents a longitudinal section view of an implant of a device according to the invention in the implant clamping phase after insertion of the plate, in an embodiment comprising a plate support free to rotate around a rehabitable hollow screw implant and fixed clamping support;\n\nFIG. 3  represents a longitudinal section view of an implant of a device according to the invention in the implant clamping phase after insertion of the plate, in an embodiment comprising a plate support free to rotate around a rehabitable hollow screw implant and inclinable clamping support;\n\nFIG. 3 a represents a partial view of an implant according to the invention, in a section along a plane passing through the centre of the support head and perpendicular to the support axis;\n\nFIG. 4  represents a longitudinal section view of an implant of a device according to the invention in the plate clamping phase once the implant is in its definitive position, in an embodiment comprising a plate support free to rotate around a rehabitable hollow screw implant and inclinable clamping support;\n\nFIGS. 5 a, 5b, 5c and 5d represent a top view of a plate of a device according to the invention, in an embodiment comprising a plate which is respectively \x93H\x94-shaped with two through openings, \x93h\x94-shaped with one through opening, with two non-through openings and with one non-through opening;\n\nFIG. 6  represents a side view of an implant of the preassembled device according to the invention, in an embodiment comprising an inclinable clamping support and a rehabitable hollow screw with two oblong holes;\n\nFIG. 7 a represents a perspective view of a longitudinal section of an implant of a device according to the invention, in an embodiment comprising an inclinable clamping support and a rehabitable hollow screw with two oblong holes and according to an alternative embodiment where the screw head housing and the support head interact without being complementary in shape;\n\nFIG. 7 b represents a partial perspective view of the support head of an implant of a device according to the invention in the same alternative embodiment;\n\nFIG. 7 c represents a partial perspective view of a cross-section along the plane AA of an implant of a device according to the invention in the same alternative embodiment;\n\nFIG. 8  represents an osteosynthesis device according to the invention in an embodiment comprising an \x93H\x94-shaped plate and two polyaxial head implants according to an alternative embodiment where the implants only comprise a single threaded part, on their outer surface.\n\nThe present invention relates to an osteosynthesis device, particularly for spinal support or correction, enabling easier and compact implantation, that can be particularly used in the case of implantation via the anterior approach, and a preassembly method for such a device. \n\nFor spinal support or correction, a device comprising one or more support bars or plates positioned along the spinal column is used, and fixed to certain vertebrae by implants. Said implants are fixed at one end to the plate and at the other end to the vertebrae by bone anchorage means, for example a threaded part screwed inside the actual vertebra. \n\nIn such devices, it is known to use a plate comprising several holes, to join the implants fixed to several vertebrae, as described in the patent FR2726171, for example. Said bars then surround or pass through the head of the screw and are locked with a nut screwed onto said head. \n\nHowever, such a device requires that the clamping nut only be fitted on the screw after the screws and the plate have been positioned. Therefore, said nut can only be inserted onto the screw head during the operation, with all the difficulties and risks of loss that may be caused by handling and assembling a small part inside a human body. This operation is all the more problematic when said operation is conducted by means of endoscopy, for example when it is necessary to implant via the anterior approach, i.e. via the front of the body or on the front face of the spine. \n\nA device according to the prior art also requires that the implants be fixed and completely clamped before the plate is positioned. Therefore, in the event of delicate operative conditions, it is difficult to successfully position the plate very close to the spine. This problem arises for example when the shape of the spine comprises too many irregularities, due to spinal displacement or deformation or in the presence of outgrowths such as osteophytes. There are similar problems in the case of implantation by the anterior approach, i.e. via the front of the body or on the front face of the spine. Indeed, the anatomical conditions in this case frequently only leave space for a compact size. In addition, it is often necessary to work by means of endoscopy in this case, which renders the operation difficult and gives a less satisfactory view of the implant insertion depth. \n\nIn some cases, to enable subsequent consolidation of the fixation between the implant and the vertebra, an implant composed of a so-called \x93rehabitable\x94 screw is used, i.e. a hollow screw wherein the inside communicates with the outside via openings passing through the threaded wall. During the screwing into the vertebra, part of the bone substance penetrates inside the screw. Over time, the bone substance fuses between the inside and outside of the screw via these openings, thus forming consolidation over time. \n\nIn this way, the patent FR 2726171 discloses a hollow screw wherein the openings are produced by cutting on the inner surfaces of said screw longitudinal grooves which cut into the base of the outer threading. However, during positioning or subsequently, such a screw may form anchoring which is not sufficiently strong and is liable to be dislodged or torn from the vertebra wherein it is implanted. \n\nOne of the aims of the invention of the invention is to propose a plate that can be fitted on preassembled implants already screwed into the spine. \n\nAnother aim of the invention is to propose an osteosynthesis device that can be partly preassembled before the operation to enable easier implantation. \n\nIn this way, the invention relates to a device as described above, characterised in that the plate has an elongated shape and comprises on at least one of its ends at least one longitudinally elongated opening, said opening having firstly at least one part opening onto an edge of the plate, or one part of a sufficiently large size to be able to be inserted without disassembly in the fixation means of an implant already screwed into the spine when said fixation means are already assembled, and secondly one part of a roughly constant width and able to slide longitudinally in the fixation means of said implant after having been inserted and of being fixed thereon; such a plate can thus be assembled by one end to an already fitted implant, and then slide in the fixation means of said implant to insert the other end in another already fitted implant, and then slide again to bring both ends into the fixation position, while the fixation means of said two implants were assembled before being fitting onto the spine. \n\nAccording to one embodiment, the plate comprises two parts of identical lengths or not, said two parts being joined together by a joining part, said joining part being located in an inner part of the plate, i.e. at a sufficient distance from the ends to enable the fixation of the plate onto two implants, at a rate of one implant on either side of said joining part. \n\nAccording to one embodiment, the joining part is located in a position offset with respect to the centre of the plate length. \n\nAccording to one embodiment, the plate has an \x93H\x94 or \x93h\x94 shape. \n\nAccording to one embodiment, the plate has at least one longitudinally elongated opening, wherein a first region is of constant width and a second region is larger in size than the first region, said opening being able to allow the fixation means of an implant to pass before sliding to bring said fixation means in the first region. \n\nAnother aim of the invention is to propose a compact osteosynthesis device, that can be fitted and adjusted in a position very close to the spine. \n\nThis aim is achieved by an osteosynthesis device, particularly for the spine, comprising a plurality of implants that can be screwed into one or more vertebrae and provide a rigid joint between said vertebrae and at least one plate or bar used to hold or displace the spine, characterised in that the plate is joined to at least one implant by fixation means able to hold said plate without preventing the implant from rotating on its screwing axis, or without preventing a specified clearance of the plate with respect to the implant, or both: thus making it possible to continue screwing the implant, or adjust the position of the plate, or both, after the plate has been assembled on the implant. \n\nAccording to one embodiment, at least one implant has an elongated shape around an axis, referred to as the implant axis, and comprises a first bone anchoring end bearing at least one threading and a second end with an elongated part passing through a plate support, said plate support being free in rotation around said elongated part, said elongated part bearing clamping means able to hold and clamp the plate against said plate support. \n\nAnother aim of the invention is to propose an osteosynthesis device that can be screwed or clamped when it is not possible to use a tool in the actual axis of the implant. \n\nThis aim is achieved by a device as described above, characterised in that the elongated part, referred to as the clamping support, of the implant is mobile with respect to the rest of the implant, along a universal type joint between a part of the implant referred to as the screw head and a part of the clamping support referred to as the support head, thus making it possible to continue screwing the implant after the plate has been assembled on the implant, by rotating the clamping support around a clamping support axis, when said axis forms a non-null angle with the axis of the implant. \n\nAccording to one embodiment, the plate surrounds the clamping support or the second end of the implant at least partly and rests on a surface of its complementary plate support, said plate support having on the implant side a concave surface in the form of a spherical portion which is supported in a complementary fashion on the outer surface of the implant screw head. \n\nAccording to one embodiment, the clamping support has a first elongated end along the support axis and a second end bearing the support head, said support head having a non-circular cross-section having at least one concave part and comprising at least one dimension greater than at least one cross-section of the first end of the clamping support; said support head having firstly one section roughly partly circular along a plane including the support axis, and being secondly arranged in the screw head inside a housing wherein the inner surface has at least one projecting part cooperating with the concave part of the support head to prevent rotation of the clamping support around its axis. \n\nAccording to one embodiment, the inner surface of the screw head housing has a shape roughly complementary to the outer surface of the support head. \n\nAccording to one embodiment, the housing receiving the support head has, on the side of said clamping head, a specified dimension to allow the clamping support a clearance along a specified angle, between the axis of the clamping support and the axis of the implant, without said clamping support escaping from said housing. \n\nAccording to one embodiment, the clamping support head has a star-shaped cross-section with rounded ends, along a plane perpendicular to the support axis. \n\nAccording to one embodiment, the clamping support clamping means comprise a threading cooperating with a nut to hold or clamp the plate against the plate support. \n\nAccording to one embodiment, the clamping support comprises at its end opposite the implant an inner or outer recess capable of receiving a rotational drive tool and thus enable the screwing or clamping of the implant in the vertebra. \n\nOne of the aims of the invention is to propose an osteosynthesis device enabling improved screw implantation strength, during fitting, during the period prior to bone fusion or after consolidation. \n\nThis aim is achieved by a device such as that described above, characterised in that the first bone anchorage end of at least one implant has a longitudinal bore concentric to its outer surface, said bore communicating with the outside by at least one bone fusion opening produced in the wall between said inner bore and said outer surface, thus enabling a fusion between the inside and the outside of the bone substance in contact with said first end. \n\nAccording to one embodiment, the first bone anchorage end of at least one implant has two threadings winding in the same direction during the screwing of the implant, and borne respectively by the outer surface of said first end and the inner surface of the bore that it comprises. \n\nAccording to one embodiment, at least one bone fusion opening has the shape of a longitudinal oblong hole. \n\nAnother aim of the invention is to propose a preassembly method for such an osteosynthesis device. \n\nThis aim is achieved by the preassembly method for a device according to the invention, characterised in that it comprises the following steps:  \n    * assembly of the plate support on the clamping support of an implant;\n    * assembly of the nut on the threading of the clamping support of said implant.\n\nIn an embodiment represented in  FIG. 2, the device according to the invention comprises an implant 1 comprising a first end 11 equipped with an outer threading 111, and is illustrated after a first screwing in the bone substance of a vertebra 0, after insertion of a plate 2 and during the final approach. Said first end 11 also comprises a cavity or an inner bore, itself equipped with an inner threading 112 wherein the screwing direction is the same as that of the outer threading 111. During the screwing of the implant into the vertebra 0, part of the bone substance tends to fill said cavity and is assisted therein by the action of the inner threading. Preferentially, the inner threading 112 and the outer threading 111 are of the same pitch, so as to minimise the strain exerted on the bone substance at the entry of the bore during screwing.\n\nThe wall between the inner cavity and the outside of the implant has one or more openings, referred to as bone fusion holes  110, in its part which is inside the vertebra after the clamping of the implant. In the periods following the implantation, generally approximately six months, the bone substance present outside and inside the implant tends to fuse. The fusing produced in this way improves the strength of said implantation, both by means of blocking via the bone fusion holes 110, and by means of cooperation of the inner threading 112 with the bone pin formed in this way.\n\nIn one alternative embodiment, the inner threading  112 has a greater pitch than that of the outer threading 111. During the screwing of the implant 1, the bone substance present inside the cavity is then attracted slightly more quickly than the implant progresses in the vertebra 0. This effect may make it possible to compensate for a filling defect liable to occur, for example by compression of the bone substance inside the bore. This effect may also make it possible to obtain more complete or more compact filling of said cavity, for example in order to obtain a specific compression or better filling of the cavity or the bone fusion holes 110, and thus favour bone substance fusion.\n\nAt its second end, i.e. opposite the vertebra, the implant  1 comprises fixation means used to insert, hold and finally clamp a bar or a plate 2. Said second end also comprises drive means using a tool of known type, such as a hexagonal recess 124.\n\nSaid fixation means comprise for example an elongated part  12a of a cross-section less than the central part of the implant, comprising a shoulder. Said elongated part 12a passes through a plate support 3 resting on said shoulder, and comprises at its end a threading 123 receiving a clamping nut 4. In one embodiment, said plate 2, FIG. 5a, is roughly \x93H\x94-shaped, comprising for example two cylindrical bars joined at their centre by a rigid distance sleeve. In an alternative embodiment, the two bars are joined by a non-rigid joint enabling more latitude in the positioning of the plate. Said plate 2 is inserted between the plate support 3 and the nut 4, so as to surround the elongated part 12a of the implant. Once the plate is in position, the nut 4 is fastened, by hand or using a tool of a known type 52, FIG. 4, and cooperates with the threading 123 to clamp the plate 2 against the plate support 3 and thus lock the fixation.\n\nIn said embodiment, the plate support  3 comprises a bore 30 with a roughly rectangular insert passing through its centre. Said plate support 3, on the side of the plate, has one or more roughly complementary surfaces 2 to the surface of the plate 2 resting on them. In said embodiment, the central bore of the plate support 3 is sufficiently larger than the part 12a passing through it to allow a clearance of said support 3 transversally and at an angle with respect to the axis d1 of the implant. Said clearance makes it possible to adjust the relative position of the plate supports of two implants 1, 1a easily, and thus insert the plate 2 easily even if the implants are not well aligned or in the event of a relatively inaccessible anatomical environment. According to an alternative embodiment not shown, the plate support receives a plate 2a, FIG. 5b, comprising a single bar at one of its ends. Said plate support can then comprise an offset bore instead of the central bore 30, without leaving the scope of the invention.\n\nSince the plate support  3 is free in rotation around the part 12a of the implant 1, it is clearly understood that it is possible to continue screwing said implant into the vertebra 0, even when the plate is already in position, provided that the fixation means are not fastened on said plate 2. In this way, by inserting the plate 2 into said fixation means before the implant 1 is not entirely screwed on, it is possible not to be hindered by the various differences in levels or outgrowths liable to be present in the immediate vicinity of the spine. Once the plate is held in place but not clamped, it is still possible to finish screwing the implant into the vertebra, by rotating it via an opening of the plate support 3. The fixation means then hold the plate 2 close to the spine, the screwing of the implant providing sufficient force to oblige the plate to come closer to the spine. Therefore, the plate can be positioned and inserted with little effort, while being positioned definitively very close to the surface of the vertebra, which makes it possible to obtain a compact device size once fitted.\n\nIn a preferential embodiment of the device according to the invention, represented in  FIGS. 3, 3a and 4, the implant 1 comprises a mobile part, referred to as the clamping support 12, at its second end opposite the first end 11 screwing into the vertebra 0. Said clamping support 12 has an elongated first end 121 along a support axis d12. Said elongated end passes through the central bore of the plate support 3 and bears a threading 123 receiving the clamping nut 4.\n\nAt a second end opposite its elongated end  121, the clamping support 12 bears a part, referred to as the support head 122, joining said clamping support 12 to the implant by its second end, referred to as the screw head 102, opposite the end 11 screwed into the vertebra 0. Along a plane perpendicular to the support axis d12, said clamping support head 122 has at least one dimension s122; FIG. 3a, greater than at least one cross-section s121 of the elongated end 121 of said clamping support 12. Said support head 122 is retained in a housing provided in the screw head 102 of the implant 1. For this purpose, said housing has an opening of a specified size s102 so as to retain the support head 122 inside said housing, while allowing a clearance of a specified angle a between the support axis d12 and the implant axis d1.\n\nSaid angular clearance of the clamping support  12 with respect to the implant enables angular and lateral movements facilitating to the insertion of the plate in the fixation means of the implant, as described below. Said angular clearance also makes it possible to compensate for any alignment defects between the different implants 1, 1a; FIG. 1c, of a device according to the invention and therefore renders the positioning of the plate 2 in the fixation means of said implants less delicate.\n\nIn said preferential embodiment, the plate support  3 rests on the screw head 102 of the implant 1, by means of a lower surface 31 composing a spherical portion for example. Said lower surface 31 of the plate support is in complementary contact with an upper surface 13 of said screw head. Said spherical complementary contact allows freedom of rotation and inclination of the plate support 3 with respect to the implant 1. Said spherical complementary contact of said surfaces 13, 31 also enables a uniform and stable support of said surfaces with respect to each other, after the plate 2 has been clamped onto the plate support, irrespective of the definitive angular position of said plate support 3 or the clamping support 12.\n\nThe implant  1 is screwed into the vertebra 0 by means of a rotational drive of said implant by rotating the clamping support 12 around its own clamping axis d12. Said clamping support is rotated for example by a tool, of known type, inserted into at least one recess 124 contained in the elongated end 121 of said clamping support. The clamping support 12 rotates the implant 1 by means of a universal type joint, i.e. the rotation of either of the two components around its axis rotates the other component around its own axis, the angle between the two axes possibly being non-null.\n\nSaid universal joint is produced by the cooperation of the outer surface  120 of the support head 122 with the inner surface 100 of the housing of the screw head 102 of the implant 1. Along a plane perpendicular to the support axis d12, the support head 12 has a section with a non-circular outline, for example in the shape of a star or cross with rounded corners, as illustrated in FIG. 3a. The housing of the screw head 102 which receives the support head 122, then has an inner surface 100 in roughly complementary contact with the outer surface 120 of said support head 122, said two surfaces 100, 120 cooperating to form the rotational join between these two components 102, 122. The angular variation is allowed by the fact that the support head 122, and its complementary housing, have a section with a circular outline along at least one plane including the clamping support axis d12, or the implant axis d1, or both.\n\nAccording to an alternative embodiment illustrated in  FIGS. 7a to 7c, the inner surface 100 of the screw head housing receiving the support head simply has one or more projecting parts 100a, for example two. The outer surface 120 of the support head 122 then has one or more concave parts 120a with which the projecting parts 100a of the screw head housing cooperate to prevent the rotation of the clamping support 12 around its axis d12.\n\nIn this way, it is clear that it is possible to continue screwing the implant  1 into the vertebra 0, while the plate 2 is already inserted between the clamping nut 4 and the plate support 3, by adjusting the elongated end 121 of the clamping support 12 accessible via the nut 4. Since the plate support 3 is free to rotate with respect to the implant 1, said implant can rotate during screwing while leaving the plate 2 and the plate support 3 immobile.\n\nOnce the implant  1 is completely screwed into the vertebra 0, as illustrated in FIG. 4, the plate 2 can then be adjusted and locked in its definitive position, by tightening the clamping nut 4. Said nut may be tightened by hand, for example on a knurled part of its outer surface on the support axis d12, or using a tool 52 of known type, for example by adjusting two inner or outer recesses on the nut.\n\nAccording to an alternative embodiment illustrated in  FIG. 8, a device according to the invention uses such implants but wherein the end 11 intended to be anchored in the vertebra only comprises one outer threaded part 111. In said alternative embodiment, the implant may comprise a longitudinal bore passing through it from one end to another, to enable positioning by means of sliding around a pin implanted beforehand in the vertebra.\n\nSeveral implants according to various alternative embodiments in the same device can of course be combined without leaving the scope of the invention. \n\nDepending on the applications, in order to join two implants  1, 1a; FIG. 1c, it is possible to use a plate of different configurations, for example such as those represented in FIGS. 5a, 5b, 5c and 5d. \n\nIn the example of an embodiment illustrated in  FIGS. 1a, 1b, and 1c, two implants 1, 1a are screwed into the body of two vertebrae 0, 0a respectively of the spine, spaced by an interval of one vertebra. These two implants are then fixed together by a plate 2 inserted into their fixation means around the clamping support and then clamped between the plate support and the nut of each of said implants.\n\nIn the preferential embodiment represented in  FIG. 5a, the plate 2 is elongated in shape and comprises two roughly parallel bars 201, 202, which are for example cylindrical, joined together in a rigid or flexible manner by a joining part 20. Said joining part joins the two bars at an inner part of the plate, i.e. at a specified non-null distance from each of the ends 21, 22 of the plate. More specifically, said joining part is located at a sufficient distance from each end of the plate so that said end can be inserted into the fixation means of an implant, and possibly slide in said fixation means. The position of said joining part 20 may be located at the centre of the plate, or be offset to allow a greater clearance for sliding during insertion as explained below.\n\nAt each end  21, 22 respectively, of the plate 2, the space between the two bars forms an opening 210, 220 respectively, opening out onto the edge of the plate. Said openings have a roughly constant transversal gap s211, s221, enabling longitudinal sliding of the plate in the fixation means of an implant 1, 1a. This roughly constant transversal gap also makes it possible to clamp said fixation means in any part of said openings 210, 220. Since said openings open onto the edge of the plate, it is possible to insert each of the ends of the plate into the fixation means of an implant 1, 1a as illustrated in FIG. 1a, without having to remove the nut 4 if it was preassembled beforehand. At each end, this insertion consists of sliding the end of the two bars between the nut 4 and the plate support 3 of the implant 1, at either side of the clamping support 12.\n\nIn another embodiment represented in  FIG. 5b, the plate 2a is elongated in shape and comprises a first end 21a comprising a single bar, which is cylindrical for example. Said first end can be inserted into an implant according to the prior art or into an implant as described in the present invention, for example in an alternative embodiment (not shown) where the plate support only comprises a single surface 32 in contact with the plate. The plate 2a also has a second end 22a comprising two roughly parallel bars, which are cylindrical for example. These two bars form a longitudinally elongated opening 220a together, of a roughly constant width s221a. Either of the two ends of said plate 2a can be inserted, or slide, or both, in the fixation means of an implant according to the invention, in the manner described in the preferential embodiment.\n\nIn another embodiment represented in  FIG. 5c, the plate 2b is elongated in shape and comprises a first end 21b having at least one opening 210b and a second end 22b having at least one second opening 220b, at least one of these openings not opening onto the edge of the plate 2b. These two openings 210b, 220b have a longitudinally elongated shape, i.e. along the length of the plate, and may be separated by one or more joining parts 20. These two openings have a roughly constant width s211b, s221b, and can be positioned by means of sliding and then be clamped in the fixation means of the implants. At least one of said openings has a part, referred to as a notch, of a larger size s210b, s220b, of a shape and size able to allow the nut 4 of the fixation means of an implant to pass through. Therefore, such a bar 2b can also be inserted in the fixation means of an implant 1 when said fixation means are already assembled, therefore not requiring handling, in the patient's body, of small parts such as the nut 4 or the plate support 3.\n\nIn an alternative embodiment represented in  FIG. 5d, the plate 2c has a single opening comprising two notches as described above (see FIG. 5c). In an embodiment not shown, the plate may comprise a sufficient number of openings and notches to be able to assemble the plate with more than two implants.\n\nIt is clear that these different types of openings, which are either through or have a wider part, can be combined in various ways without leaving the scope of the invention. \n\nIn the same way, the position of the joining part  20 can vary and be offset along the length of the plate, so as to leave the clearance required for the plate to slide during positioning. In a preferential embodiment, said position is slightly offset with respect to the centre of the plate, so as to be able to slide the plate sufficiently in the first implant 1; FIG. 1b, to be able to insert it into the second implant 1a. \n\nIt is necessary to understand here that the device described can equally well comprise any other combination of different alternative embodiments of plates and alternative embodiments of implants without leaving the scope of the invention. \n\nFIGS. 1 a, 1b, and 1c illustrate different steps in the positioning of the plate 2 in two implants 1, 1a, in the preferential embodiment. This positioning is carried out while the implants are already screwed into the spine, their fixation means, in this case the plate support 3 and the nut 4 being alrea..."
 "BRIEF DESCRIPTION OF THE DRAWINGS \n\nIn  FIGS. 1a, 2a, 3a, 4a, 5a, 6a and 7a, cells were treated with rapamycin (Rapa), doxorubicin (Doxo) or dexrazoxone (DexRaz). In FIGS. 1b, 2b, 3b, 4b, 5b, 6b and 7b, cells were subject to oxidative stress alone or following pre-treatment with rapamycin or dexrazoxone. In FIGS. 1c, 2c, 3c, 4c, 5c, 6c and 7c, cells were treated with doxorubicin alone, or following treatment with rapamycin or dexrazoxone. Various effects of the indicated treatments were measured on day 1 (d1) and day 2 (d2).\n\nFIG. 1  illustrates the effects of cell cycle inhibitor drugs and oxidative stress on cell survival and proliferation, as measured using an MTT proliferation assay. FIG. 1a shows the effect of different drugs on cell survival and proliferation. FIG. 1b shows the effects of oxidative stress on cell survival and proliferation. FIG. 1c shows the effects of doxorubicine on cell survival and proliferation.\n\nFIG. 2  illustrates the effects of cell cycle inhibitor drugs and oxidative stress on apoptosis, as measured using FACS analysis. FIG. 2a shows the effect of cell cycle regulator drugs on apoptosis. FIG. 2b shows the effects of oxidative stress on apoptosis. FIG. 2c shows the effects of doxorubicine on apoptosis.\n\nFIG. 3  illustrates the effects of cell cycle inhibitor drugs and oxidative stress on length of the G1 phase of the cell cycle. The y-axis is relative lengthening of the G1 phase of the cell cycle expressed as a percentage. FIG. 3a shows the effect of various drugs on the length of the G1 phase of the cell cycle. FIG. 3b shows the effect of sub-lethal oxidative stress on the length of the G1 phase of the cell cycle. FIG. 3c shows the effect of doxorubicine on the length of the G1 phase of the cell cycle.\n\nFIG. 4  illustrates the effects of cell cycle inhibitor drugs and oxidative stress on length of the G2 phase of the cell cycle. The y-axis is relative lengthening of the G3 phase of the cell cycle expressed as a percentage. FIG. 4a shows the relative change of G2 length under the effect of cell cycle inhibitors. FIG. 4b shows the relative change of G2 length under the effect of oxidative stress. FIG. 4c shows the relative change of G2 length under the effect of doxorubicine.\n\nFIG. 5  illustrates the effects of cell cycle inhibitor drugs and oxidative stress on expression of amyloid precursor protein (APP). The y-axis is percent increase in the amount of protein relative to untreated control culture. The absolute values used to perform this analysis were derived from optical density measurements (OD) obtained from the ELISA assay performed. FIG. 5a shows the effect of cell cycle inhibitor drugs on APP expression. FIG. 5b shows the effect of oxidative stress on APP expression. FIG. 5c shows the effect of doxorubicine on APP expression.\n\nFIG. 6  illustrates the effects of cell cycle inhibitor drugs and oxidative stress on expression of AD-type hyperphosphorylated tau. The y-axis is percent increase in the amount of protein relative to untreated control culture. The absolute values used to perform this analysis were derived from optical density measurements (OD) obtained from the ELISA assay performed. FIG. 6a shows the effect of cell cycle inhibitor drugs on the expression of AD-type hyperphosphorylated tau. FIG. 6b shows the effect of oxidative stress on the expression of AD-type hyperphosphorylated tau. FIG. 6c shows the effect of doxorubicine on the expression of AD-type hyperphosphorylated tau.\n\nFIG. 7  illustrates the effects of cell cycle inhibitor drugs and oxidative stress on expression of AD-type PHF tau. The y-axis is percent increase in the amount of protein relative to untreated control culture. The absolute values used to perform this analysis were derived from optical density measurements (OD) obtained from the ELISA assay performed. FIG. 7a shows the effect of cell cycle inhibitor drugs on the expression of AD-type PHF tau. FIG. 7b shows the effect of oxidative stress on the expression of AD-type PHF tau. FIG. 7c shows the effect of doxorubicine on the expression of AD-type PHF tau.\n\nCROSS-REFERENCE TO RELATED APPLICATIONS \n\nThis application claims priority to U.S. patent application Ser. No. 10/200,023 (filed on Jul. 19, 2002; pending), which application claims priority to GB 0117645.2 (filed Jul. 19, 2001), each of which applications are herein incorporated by reference in its entirety. \n\nFIELD OF THE INVENTION \n\nThe present invention relates to novel strategies for treatment and prevention of Alzheimer's disease. \n\nBACKGROUND OF THE INVENTION \n\nAs life expectancy increases Alzheimer's disease (AD) is becoming a major health problem in the western world. There has been intensive research aimed at identifying a reliable cure or preventive measures for the disease, so far without success. \n\nCurrently there are two mainstream therapeutic approaches to the treatment of Alzheimer's disease. The first is treatment with acetylcholine esterase inhibitors, which reduce the effects of neuron loss in the central nervous system and therefore provide some symptomatic relief for the cognitive defects. However, this approach is appropriate only in those patients in which there is substantial functional reserve left in the brain. \n\nThe second approach is to reduce the amount of or stop the deposition of beta-amyloid plaques in the brain. The main drawback of this approach is that amyloid deposition is not the cause but rather a consequence of Alzheimer's disease, and the accumulation of this protein does not have any effect on the cognitive status or functional capacity of the brain. \n\nIn recent years it is becoming more widely accepted that the pathogenic basis of Alzheimer's disease is the aberrant re-entry of different neuronal populations into the cell division cycle (Nagy Z, Esiri M M and Smith A D (1998)  Neuroscience 84: 731-739). In healthy elderly individuals rapid cell cycle arrest and re-differentiation may follow this cell cycle re-entry. In contrast, in individuals with Alzheimer's disease the regulatory mechanisms appear to fail and the neurons progress into the late stages of the cell cycle leading to the accumulation of AD-related pathology and/or neuronal death (Nagy Z, Esiri M M and Smith A D (1998) Neuroscience 84: 731-739).\n\nStudies by the present inventors and others indicate that the cell cycle regulatory failure in Alzheimer's disease occurs at the G1/S transition checkpoint (Arendt T, Rodel L, Gartner U and Holzer M (1996)  Neuroreport 7: 3047-9). Previous studies on fibroblasts and lymphocytes from Alzheimer's disease patients indicate that the regulation of the cell division cycle might be disrupted in cells other than neurons in this condition (Eckert A, Hartmann H, Forstl H and Muller W E (1994) Life Sci 55: 2019-29; Fischman H K, Reisberg B, Albu P, Ferris S H and Rainer J D (1984) Biol Psychiatry 19: 319-27; Tatebayashi Y, Takeda M, Kashiwagi Y, Okochi M, Kurumadani T, Sekiyama A, Kanayama G, Hariguchi S and Nishimura T (1995) Dementia 6: 9-16). It is also known that Alzheimer's disease patients are more prone to some forms of cancer (Burke W J, McLaughlin J R, Chung H D, Gillespie K N, Grossbcrg G T, Luque F A and Zimmerman J (1994) Alzheimer Dis Assoc Disord 8: 22-8) and that Down's syndrome patients, who develop AD in early adult life, are more prone to leukaemia than the general population (Drabkin H A and Erickson P (1995) Prog Clin Biol Res 393: 169-76; Fong C T and Brodeur G M (1987) Cancer Genet Cytogenet 28: 55-76). It is plausible therefore to hypothesize that the cell cycle regulatory failure in neurons, even in early (pre-clinical) stages of AD, might be reflected by similar cell cycle regulatory malfunction in lymphocytes.\n\nSUMMARY OF THE INVENTION \n\nThe present inventor has shown that the in vitro responsiveness of lymphocytes to G1 inhibitor treatment is significantly less effective in Alzheimer's disease patients than in control subjects. Additionally, in subjects showing clinical signs of incipient Alzheimer's disease the lymphocyte response is similar to that seen in Alzheimer's disease patients. These findings represent direct evidence that failure of the G1/S transition control is not restricted to neurons in Alzheimer's disease patients, but also occurs in peripheral cells, such as lymphocytes. \n\nThe two main targets of therapeutic intervention identified by the inventor are to prevent/inhibit cell cycle re-entry and progression to the G1/S transition point, or to prevent/inhibit the cell cycle progression at the G1/S transition point. \n\nAccording to one aspect of the invention, methods of treating or preventing Alzheimer's disease in a human patient are provided. The methods include administering to a human patient in need thereof an effective amount of one or more inhibitors of cell cycle re-entry and progression to the G1/S transition. In certain embodiments, the inhibitor of cell cycle re-entry and progression to the G1/S transition is an inhibitor of the G0/G1 transition, and in other embodiments the inhibitor of cell cycle re-entry and progression to the G1/S transition induces cell cycle arrest in the G0/G1 phase. \n\nPreferred inhibitors of cell cycle re-entry and progression to the G1/S transition for use in the foregoing methods include NA22598, sodium valproate, fascaplysin and brefeldin A. \n\nAccording to another aspect of the invention, additional methods of treating or preventing Alzheimer's disease in a human patient are provided. The methods include administering to a human patient in need thereof an effective amount of one or more inhibitors of progression of the cell cycle through the G1/S transition point. In some embodiments, the inhibitor of progression of the cell cycle through the G1/S transition point blocks cell cycle progression in G1, and/or induces cell cycle arrest in G1, and/or induces cell cycle arrest at the G1/S checkpoint, and/or blocks the G1/S transition, and/or inhibits DNA synthesis. \n\nPreferred inhibitors of progression of the cell cycle through the G1/S transition point include squamocin, peptide aptamers which specifically inhibit E2F binding activity, manumycin A, indole carbazolc K252a, 4-sodium phenyl butyrate, retinoids or retinoid receptor selective ligands, combinations of oncostatin M and interleukin 6, an ansamycin (preferably herbimycin, geldanamycin or TT-B), vitamin D analogs, steroids or glucocorticoids, alpha adrenergic receptor antagonists (preferably doxazosin), iron chelators (preferably O-Trensox, desferrioxamine, an aroylhydrazone ligand, dexrazoxane or EDTA), angiotensin II receptor antagonists (preferably bradykinin), immunosuppressive chemotherapeutic drugs (preferably doxorubicin, adriamycin, rapamycin, cyclosporin A, FK506 or a prodigiosin), and melatonin. \n\nThe foregoing inhibitors of cell cycle re-entry and progression to the G1/S transition and inhibitors of progression of the cell cycle through the G1/S transition point can be administered alone or in combination with other of these inhibitors, or in combination with one or more non-cell cycle therapeutic agents for treating Alzheimer's disease, such as acetylcholine esterase inhibitors (such as donepezil, rivastigmine and galantamine), beta- and gamma-secretase inhibitors, Abeta vaccines, Cu\x97Zn chelators, cholesterol-lowering drugs and non-steroidal anti-inflammatory drugs. Preferred combinations of cell cycle therapeutic agents include doxorubicin and rapamycin (particularly administration of the rapamycin followed by the administration of the doxorubicin), and dexrazoxane and doxorubicin (particularly administration of the dexrazoxone followed by the administration of the doxorubicin). \n\nAccording to a further aspect of the invention, methods of selecting a pharmaceutical agent for use in the treatment Alzheimer's disease in a human patient are provided. The methods include the steps of (a) exposing cells from the patient, which cells are non-neuronal cells that exhibit a cell cycle regulatory defect at the G1/S phase transition, to a panel of pharmaceutical agents which are known inhibitors of cell cycle re-entry and progression to the G1/S transition or known inhibitors of progression of the cell cycle through the G1/S transition point, (b) analyzing the regulation of the G1/S transition the cells in the presence and absence of the pharmacological agents, and (c) identifying an agent which corrects the regulatory defect at the G1/S transition in the cells, which agent is identified as likely to be of benefit in the treatment of Alzheimer's disease in the patient. In some embodiments, the panel of pharmaceutical agents includes one or more inhibitors of cell cycle re-entry and progression to the G1/S transition and/or one or more inhibitors of progression of the cell cycle through the G1/S transition point as described herein. \n\nIn another aspect of the invention, methods of screening compounds for potential pharmacological activity in the treatment of Alzheimer's disease are provided. The methods include contacting SH-SY5Y neuroblastoma cells with candidate compounds and testing for at least one parameter indicative of Alzheimer's disease pathology selected from the group consisting of: (i) cell survival and proliferation, (ii) apoptosis, (iii) relative lengthening of the G1 phase of the cell cycle, (iv) relative lengthening of the G2 phase of the cell cycle, (v) expression of amyloid precursor protein (APP), (vi) expression of hyperphosphorylated tau protein, and (vii) expression of PHF tau protein. Candidate compounds which cause a reduction in the tested parameter(s), as compared to control cells not exposed to the candidate compound, are scored as having potential pharmacological activity in the treatment of Alzheimer's disease. \n\nIn some embodiments, the candidate compound to be tested using the method is a known inhibitor of cell cycle re-entry and progression to the G1/S transition or a known inhibitor of progression of the cell cycle through the GUS transition point. \n\nAccording to yet another aspect of the invention, pharmaceutical kits for treating Alzheimer's disease are provided. The kits include a therapeutically effective amount of one or more cell cycle therapeutic agents for treating Alzheimer's disease selected from one or more inhibitors of cell cycle re-entry and progression to the G1/S transition and/or inhibitors of progression of the cell cycle through the G1/S transition point. In certain embodiments, combinations of cell cycle therapeutic agents are provided in the kits, such as doxorubicin and rapamycin, or dexrazoxone and doxorubicin. In other embodiments, the kits can also include a non-cell cycle therapeutic agent for treating Alzheimer's disease. The kits preferably also will contain instructions for simultaneous, separate or sequential administration of the cell cycle therapeutic agent and optionally the non-cell cycle therapeutic agent for treating Alzheimer's disease. \n\nThese and other embodiments of the invention are described in greater detail below. \n\nDETAILED DESCRIPTION OF THE INVENTION \n\nThe invention relates to several strategies for therapeutic intervention in order to arrest progression of Alzheimer's disease or to prevent its development. \n\nThe two main targets of therapeutic intervention identified by the inventor are to prevent/inhibit cell cycle re-entry and progression to the G1/S transition point, or to prevent/inhibit the cell cycle progression at the G1/S transition point. Neuronal cell cycle re-entry can be prevented by therapies that act as differentiation factors or by interventions that reinforce synaptic connections and therefore the differentiated state of neurons. Therapies aimed at arresting the progression of the cell division cycle at the G1/S transition point include treatment with classical inhibitors of cell division, for example drugs used in cancer therapy and chemo-prevention. \n\nThe preferred agent for treatment of Alzheimer's disease in any given patient will vary depending on the precise nature of the underlying cell cycle regulatory defect present in that patient. It is not the case that all agents that prevent cell cycle re-entry and progression to the G1/S transition point, or which prevent the cell cycle progression at the G1/S transition point, will be effective in all Alzheimer's patients. The inventor's finding that the failure of the G1/S transition control is not restricted to neurons in Alzheimer's disease patients, but also occurs in peripheral cells, such as lymphocytes, has led to the development of an in vitro assay which can be used to identify and select agents which are effective in a particular patient. The ability to select an agent that will work in a given patient via a simple in vitro test is absolutely critical. Prior to the development of this in vitro screen it would simply not have been possible to select an agent having clinical utility in a particular patient without to extensive, ethically unacceptable, \x93trial and error\x94 in that patient. \n\nIn summary, the development of an in vitro screen which can be used identify agents capable of correcting the cell cycle regulatory defects present in Alzheimer's patients has made it possible for the first time to provide effective treatment and prophylaxis for Alzheimer's disease based on prevention/inhibition of cell cycle re-entry and progression to the G1/S transition point, or on prevention/inhibition of cell cycle progression at the G1/S transition point. \n\nTherefore, in a first aspect the invention relates to use of at least one substance which is an inhibitor of cell cycle re-entry and progression to the G1/S transition for the manufacture of a medicament for the treatment or prevention of Alzheimer's disease. \n\nThe invention is also directed to method of treating or preventing Alzheimer's disease in a human patient comprising administering to a human patient in need thereof an effective amount of an inhibitor of cell cycle re-entry and progression to the G1/S transition. \n\nInhibitors of cell cycle re-entry and progression to the G1/S transition may act via various mechanisms, for example inhibition of the G0/G1 transition, or induction of cell cycle arrest in the G0/G1 phase. \n\nPreferably the inhibitor of cell cycle re-entry and progression to the G1/S transition will be a substance that, when assessed using the in vitro assay described herein, produces significant correction of the cell cycle regulatory defect at the G1/S transition in an Alzheimer's patient, most preferably the Alzheimer's patient which it is intended to treat using the substance. \n\nPreferred known inhibitors of cell cycle re-entry and progression to the G1/S transition, which may be used in accordance with this aspect of the invention, include the following, however this is not to be construed as limiting the invention to these specific embodiments: \n\nNA22598\x97an anticancer drug that inhibits G0/G1 transition (Kawada, M., Kuwahara, A., et al. (1999)  Exp Cell Res, 249(2): 240-247).\n\nSodium valproate and its derivatives\x97an inhibitor of the growth of human neuroblastoma cells and known antiepileptic agent (Cinatl, J. Jr., Cinatl, J., et al. (1997)  Anticancer Drugs, 8(10): 958-963; Cinatl, J. Jr., Cinatl, J., et al. (1996) Anticancer Drugs, 7(7): 766-773).\n\nFascaplysin\x97which specifically inhibits cdk4 therefore inhibiting the G0/G1 transition (Soni, R., Muller, L., et al. (2000).  Biochem Biophys Res Comm, 275(3): 877-884).\n\nBrefeldin A\x97which induces cell cycle arrest in the G0/G1 phase (Nojiri, H., Manya, H., et al. (1999)  FEBS Lett, 453(1-2): 140-144).\n\nIn a second aspect the invention is relates to use of at least one substance which is an inhibitor of progression of the cell cycle through the G1/S transition point for the manufacture of a medicament for the treatment or prevention of Alzheimer's disease. \n\nThe invention is also directed to a method of treating or preventing Alzheimer's disease in a human patient comprising administering to a human patient in need thereof an effective amount of an inhibitor of progression of the cell cycle through the G1/S transition point. \n\nInhibitors of progression of the cell cycle through the G1/S transition point may act via various mechanisms. For example, they may block cell cycle progression in G1, induce cell cycle arrest in G1, induce cell cycle arrest at the G1/S checkpoint via various pathways, block the G1/S transition, or inhibit DNA synthesis. \n\nPreferably the inhibitor of progression of the cell cycle through the G1/S transition point will be a substance that, when assessed using the in vitro assay described herein, produces significant correction of the cell cycle regulatory defect at the G1/S transition in an Alzheimer's patient, most preferably the Alzheimer's patient which it is intended to treat using the substance. \n\nPreferred known inhibitors of progression of the cell cycle through the G1/S transition point, which may be used in accordance with this aspect of the invention, include the following, however this is not to be construed as limiting the invention to these specific embodiments: \n\nSquamocin\x97an annonaceous acetogenin which blocks cell cycle progression in the G1 phase (Raynaud, S., Nemati, F., et al. (1999)  Life Science, 65(5): 525-533).\n\nPeptide aptamers that functionally antagonize E2F activity\x97suitable peptide aptamers are those described and shown to be inhibitors of the cell cycle in G1 by Fabbrizio, E., Le Cam, L., et al. (1999)  Oncogene, 18(30): 4357-4363.\n\nManumycin A\x97shown to cause G1 arrest (Wang, W. and Macaulay, R. J. (1999)  Int J Cancer, 82(3): 430-434).\n\nIndole carbazole K252a\x97a compound shown to cause cell cycle arrest at the G1/S checkpoint via p21 (Chin, L. S., Murray, S. F., et al. (1999)  Cancer Invest., 17(6): 391-395).\n\nOncostatin M and interleukin 6 in combination\x97this combination of cytokines induces cell cycle arrest at G1/S via p27 (Klausen, P., Pedersen, L., et al. (2000)  Oncogene, 19(32): 3675-3683).\n\n4-sodium phenylbutyrate\x97an agent that has been used for many years in the treatment of urea cycle defects, which has been shown to cause cell cycle arrest in G1 via p21 (McGrath-Morrow, S. A. and Stahl, J. L. (2000)  J Pharmacol Exp Ther, 294(3): 941-947).\n\nRetinoids and retinoid receptor selective ligands (e.g. ligands which mimic the effect of retinoic acid binding to the retinoid receptor, for example Targretin)\x97suitable retinoids include retinoic acid, which has been shown to mediate cell cycle arrest in G1 (Hsu, S. L., Hsu, J. W. et al. (2000)  Exp Cell Res, 258(2): 322-331).\n\nAnsamycins\x97members of the ansamycin class of antibiotics have been shown to inhibit the growth of human tumor cell lines in vitro. Suitable ansamycins include thiazinotrienomycin B (TT-B), shown to inhibit cell cycle progression from G0/G1 to S (Hosokawa, N., Yamamoto, S., et al. (1999)  J. Antibiot, 52(5): 485-490; Hosokawa, N., Naganawa, H., et al. (2000) J. Antibiot, 53(9): 886-894), and related compounds such as, for example, herbimycin and geldanamycin.\n\nVitamin D analogs\x97suitable analogs include, but are not limited to, the compounds EB1089 and CB1093, which have been shown to cause cell cycle arrest in the G0/G1 phase (Pettersson, F., Colston, K. W., et al. (2000)  Br J Cancer, 83(2): 239-245).\n\nGlucocorticoids\x97suitable glucocorticoids include, but are not limited to, the synthetic glucocorticoid dexamethasone, which has been shown to induce cell cycle arrest in G1 via p27 and p57 (Samuelsson, M. K., Pazirandeh, A., et al. (1999)  Mol Endocrinol, 13(11): 1811-1822).\n\nAlpha adrenergic receptor antagonists\x97suitable examples include the alpha1-adrenergic receptor antagonist doxazosin, which has been shown to induce cell cycle arrest in G1 via p27 (Kintsher, U., Kon, D., et al. (2001)  J Cardiovasc Pharmacol, 37(5): 532-539; Kintsher, U., Wakino, S., et al. (2000) Arterioscler Thromb Vasc Biol, 20(5): 1216-1224).\n\nIron chelators\x97suitable examples include EDTA, dexrazoxane, the synthetic iron chelator O-Trensox and desferrioxamine, both of which have been shown to block the G1/S transition (Rakba, N., Loyer, P., et al. (2000)  Carcinogenesis, 21(5): 943-951) and also aroylhydrazone iron chelators of the pyridoxal isonicotinoyl hydrazone class, such as those shown by Becker, E. and Richardson, D. R. (1999) J Lab Clin Med, 134(5): 510-521 to be mediators of cell cycle arrest at G1/S.\n\nAngiotensin II receptor antagonists\x97suitable examples include bradykinin, which is known to inhibit DNA synthesis (Patel, K. V. and Schrey, M. P. (1992)  Cancer Res, 52(2): 334-340).\n\nImmunosuppressive chemotherapeutic drugs\x97suitable examples are Doxorubicin, Adriamycin, Rapamycin, Cyclosporin A, FK506 (Tacrolimus) and compounds of the prodigiosin family. These immunosuppressive drugs are all known to promote G1 inhibition via p21 and p27. \n\nMelatonin\x97which is known to induce G1/S inhibition (Urata, Y., Honma, S., et al. (1999)  Free Radic Biol Med, 27(7-8): 838-847).\n\nThe above agents may also be used in combination in order to achieve the desired therapeutic effect. Certain combinations of agents may act co-operatively, additively or synergistically, when co-administered or when administered sequentially. A preferred combination is doxorubicin with rapamycin. Most preferably the two agents are administered sequentially, rapamycin followed by doxorubicin. As illustrated in the accompanying Examples, a combined treatment with rapamycin and doxorubicin has a strong protective effect against the accumulation of AD-related proteins. A further preferred combination is dexrazoxane with doxorubicin. Again the two agents are most preferably administered sequentially, dexrazoxone followed by doxorubicin. As illustrated in the accompanying Examples, treatment with dexrazoxane followed by doxorubicin enhances protection against AD-related protein expression. \n\nThe invention is also directed to the use of pharmaceutically acceptable salts of the agents listed above, and to derivatives of the listed agents which retain the desired activity of inhibiting cell cycle re-entry and progression to the G1/S transition point, or inhibiting cell cycle progression at the G1/S transition point. Derivatives that substantially retain the same activity as the starting material, or more preferably exhibit improved activity, may be produced according to standard principles of medicinal chemistry, which are well known in the art. Such derivatives may exhibit a lesser degree of activity than the starting material, so long as they retain sufficient activity to be therapeutically effective. Derivatives may exhibit improvements in other properties that are desirable in pharmaceutical active agents such as, for example, improved solubility, reduced toxicity, enhanced uptake into the brain, etc. \n\nThe above-listed agents, or pharmaceutically acceptable salts or derivatives thereof, may be formulated into pharmaceutical dosage forms, together with suitable pharmaceutically acceptable carriers, such as diluents, fillers, salts, buffers, stabilizers, solubilizers, etc. The dosage form may contain other pharmaceutically acceptable excipients for modifying conditions such as pH, osmolarity, taste, viscosity, sterility, lipophilicity, solubility etc. \n\nSuitable dosage forms include solid dosage forms, for example, tablets, capsules, powders, dispersible granules, cachets and suppositories, including sustained release and delayed release formulations. Powders and tablets will generally comprise from about 5% to about 70% active ingredient. Suitable solid carriers and excipients are generally known in the art and include, e.g. magnesium carbonate, magnesium stearate, talc, sugar, lactose, etc. Tablets, powders, cachets and capsules are all suitable dosage forms for oral administration. \n\nLiquid dosage forms include solutions, suspensions and emulsions. Liquid form preparations may be administered by intravenous, intracerebral, intraperitoneal, parenteral or intramuscular injection or infusion. Sterile injectable formulations may comprise a sterile solution or suspension of the active agent in a non-toxic, pharmaceutically acceptable diluent or solvent. Suitable diluents and solvents include sterile water, Ringer's solution and isotonic sodium chloride solution, etc. Liquid dosage forms also include solutions or sprays for intranasal administration. \n\nAerosol preparations suitable for inhalation may include solutions and solids in powder form, which may be combined with a pharmaceutically acceptable carrier, such as an inert compressed gas. \n\nAlso encompassed are dosage forms for transdermal administration, including creams, lotions, aerosols and/or emulsions. These dosage forms may be included in transdermal patches of the matrix or reservoir type, which are generally known in the art. \n\nPharmaceutical preparations may be conveniently prepared in unit dosage form, according to standard procedures of pharmaceutical formulation. The quantity of active compound per unit dose may be varied according to the nature of the active compound and the intended dosage regime. Generally this will be within the range 0.1 mg to 1000 mg. \n\nOther delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of the therapeutic agents of the invention described herein, increasing convenience to the subject and the physician. Many types of release delivery systems are available and known to those of ordinary skill in the art. They include polymer based systems such as poly(lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides. Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S. Pat. No. 5,075,109. Delivery systems also include non-polymer systems that are: lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono- di- and tri-glycerides; hydrogel release systems; sylastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like. Specific examples include, but are not limited to: (a) erosional systems in which the therapeutic agent(s) of the invention are contained in a form within a matrix such as those described in U.S. Pat. Nos. 4,452,775, 4,675,189, and 5,736,152, and (b) diffusional systems in which an active component permeates at a controlled rate from a polymer such as described in U.S. Pat. Nos. 3,854,480, 5,133,974 and 5,407,686. In addition, pump-based hardware delivery systems can be used, some of which are adapted for implantation. \n\nUse of a long-term sustained release implant may be particularly suitable for treatment of chronic conditions such as Alzheimer's disease. Long-term release, are used herein, means that the implant is constructed and arranged to delivery therapeutic levels of the active ingredient for at least 30 days, and preferably 60 days. Long-term sustained release implants are well-known to those of ordinary skill in the art and include some of the release systems described above. \n\nIn some embodiments, the invention involves co-administration of at least two different types of therapeutic agent for treating Alzheimer's disease. Thus, the invention provides methods and products for combination therapy in which a first therapeutic agent (e.g., an inhibitor of cell cycle re-entry and progression to the G1/S tra..."]


Assignee/Applicant (Original Language)
['Euro-Pro Operating LLC,Newton,MA,US'
 'Sikorsky Aircraft Corporation,Stratford,CT,US'
 'Vectura Limited,Chippenham, Wiltshire,GB | Staniforth John Nicholas,Bath,GB'
 ...
 'Technische Universität München,München,DE | Holm Per Sonne,Fürstenfeldbruck,DE'
 'LDR Medical,Rosières Près Troyes,FR | Delecrin Joël,Vertou,FR | Allain Jérôme,Paris,FR | Tropiano Patrick,Marseille,FR | Ganglof Serge,Aplerin,FR | Poncer Rémi,Vannes,FR'
 'Isis Innovation Ltd.,Oxford,GB']


Assignee - Original
['Euro-Pro Operating LLC' 'Sikorsky Aircraft Corporation'
 'Vectura Limited | Staniforth John Nicholas' ...
 'Technische Universität München | Holm Per Sonne'
 'LDR Medical | Delecrin Joël | Allain Jérôme | Tropiano Patrick | Ganglof Serge | Poncer Rémi'
 'Isis Innovation Ltd.']


Optimized Assignee
['SHARKNINJA OPERATING LLC (FORMERLY EURO-PRO OPERATING LLC) | COMPASS CAYMAN SPV 2 LIMITED | SHARKNINJA SALES COMPANY | COMPASS CAYMAN SPV LTD. | EP MIDCO LLC | SHARKNINJA MANAGEMENT COMPANY | EURO-PRO HOLDCO LLC | GLOBAL APPLIANCE UK HOLDCO LIMITED | GLOBAL APPLIANCE TECHNOLOGIES INC'
 'SIKORSKY AIRCRAFT CORPORATION' 'VECTURA GROUP PLC' ...
 'VASCULAR DYNAMICS INC' 'TECHNISCHE UNIVERSITAT MUNICH'
 'LCR HOLDING CORP']


Ultimate Parent
['SHARKNINJA OPERATING LLC (FORMERLY EURO-PRO OPERATING LLC) | COMPASS CAYMAN SPV 2 LIMITED | SHARKNINJA SALES COMPANY | COMPASS CAYMAN SPV LTD. | EP MIDCO LLC | SHARKNINJA MANAGEMENT COMPANY | EURO-PRO HOLDCO LLC | GLOBAL APPLIANCE UK HOLDCO LIMITED | GLOBAL APPLIANCE TECHNOLOGIES INC'
 'LOCKHEED MARTIN CORP.' 'VECTURA GROUP PLC' ... 'VASCULAR DYNAMICS INC'
 'TECHNISCHE UNIVERSITAT MUNICH'
 'ZIMVIE INC. (SPINOFF OF DENTAL & SPINE BUSINESS)']


Inventor
['Breit, Oliver Rudolph' 'Welsh, William A.' 'Staniforth, John Nicholas'
 ... 'Holm, Per Sonne'
 'Delecrin, Joël | Allain, Jérôme | Tropiano, Patrick | Ganglof, Serge | Poncer, Rémi'
 'Nagy, Zsuzsanna']


Attorney/Agent
['Wolf, Greenfield & Sacks, P.C.' 'Carlson, Gaskey & Olds P.C.'
 'Merchant & Gould P.C.' ... 'Wagenknecht IP Law Group PC'
 'Denko Coburn Lauff LLP'
 'Auerbach, Jeffrey I. | Kreppel, Lisa | AuerbachSchrot LLC']


Examiner
['Ko, Jason' 'Dinh, Tien / Kreiner, Michael' 'Haghighatian, Mina' ...
 'Ketter, Jim' 'Vuong, Quochien B' 'Philogene, Pedro / Comstock, David']


Publication Country Code
['US']


Dead/Alive
['Alive' 'Dead']


Application Country/Region
['US']


Priority Date - Earliest
['2009-09-25' '2008-03-20' '1995-01-31' ... '2001-10-16' '2001-10-18'
 '2001-07-19']


IPC Class
['B08, A47' 'B64, F01, F16, G01, H02' 'A61' 'C12' 'H04, G06, G09, G11'
 'G06, H04' 'H01' 'G06' 'A61, C12, C07' 'H04' 'C07, A61' 'G06, G09'
 'C12, A61' 'C12, G01, G06' 'A63' 'H04, A61, G01'
 'B44, B32, G02, G03, H01' 'B01, A61, G01' 'F23, C10' 'H01, C07, C09, H05'
 'C12, B01, G01' 'G06, G01, G05, G08, H04' 'A61, C07, G01, H01' 'G09, G06'
 'B42, G03' 'G05, F22, F23, F28' 'B23, G01, G06' 'A61, C07, C12, G01'
 'G06, G11' 'A47, B60' 'A62, A01, A61' 'A61, C07' 'C07, A61, C12'
 'G02, G09' 'B60, B61' 'F02, F23' 'A61, C07, C12' 'H04, G06'
 'G06, H01, H04' 'F25' 'H03, H04' 'H01, C08' 'B41, H04'
 'A61, B01, C02, F16, G01, H01' 'B29, C09, G02' 'A61, B25' 'C30, B01, C07'
 'B01, C01, H01' 'A61, A23' 'B29' 'F16, B60' 'H01, H05' 'C07' 'B01, C02'
 'A24, A01, A61, A44' 'A61, B08, C23, C25' 'H04, G11' 'F16'
 'C07, C09, G01' 'C08' 'C07, C13, B01' 'B23' 'C08, C07, C10' 'G01, B01'
 'H04, G02' 'F16, F03' 'C12, C13' 'A61, G01' 'C40, C12, G01'
 'G05, B60, H04' 'B64' 'G06, G09, H04' 'E04' 'H01, C09, H05' 'C11, C23'
 'H01, C25' 'C08, C22' 'A61, F16' 'G09' 'A47' 'F04, F16, F01'
 'C09, C07, D21' 'A61, G06, G16' 'B41' 'H01, B82'
 'C12, A01, B01, B82, G01' 'G01' 'H04, A61' 'A61, C12' 'A61, A01'
 'D06, H02' 'A23, A61' 'A61, D04, D06, D21' 'H01, C04, C23'
 'C09, H01, H05' 'H04, H03' 'B60, H01' 'C10' 'D06, C07' 'H01, B05'
 'C10, F16' 'G06, B32, H03' 'B32, A63, C09, F42' 'G06, A61' 'A61, B05'
 'B60' 'G09, A61, G06, G08, G02' 'A61, A62' 'C12, A21, A23, A61'
 'G01, F16, B01' 'A61, A23, A62, F25' 'B01, F28' 'B01, F16, G01'
 'C09, C07, H01, H05' 'A01, A61' 'G06, G07, H04' 'B05, C08, E04' 'B21'
 'H04, G01' 'A61, C08' 'H01, C07' 'G11, G03' 'A01, A61, D21' 'G06, G01'
 'D06, F26' 'E05' 'G11, H01' 'B31' 'B25, G06, G05' 'B23, F01' 'B32, B21'
 'H05' 'B64, F02, E05' 'F21' 'A61, B65' 'G06, G03' 'D21, C08' 'C12, B01'
 'D02, D01, D03, D04, F16' 'C30, H01' 'G01, H04' 'F01, F04' 'H01, B25'
 'C21, C10, C22' 'B65, A47' 'D06' 'B32, B64' 'A01, A61, C07'
 'F21, G02, H01' 'G08, A61' 'D21' 'G06, G05, G08' 'A47, A61, F16'
 'G08, H04, G06' 'H02, H01' 'G01, A61, G16, B01' 'G01, H01, B82'
 'C12, A01' 'B30, B29' 'C23, B05, H01' 'B21, B23' 'B01, C12, C40, G01'
 'G02, B81' 'B24, B27, B05' 'A01, A23, C07, C12' 'C22' 'G09, G06, H04'
 'F16, A61' 'C07, B01' 'B05, B60' 'A42, F41, B29' 'B65, B01' 'B21, F02'
 'G02' 'B29, B32' 'B65, A45, A46, A47, A61' 'F28, F25, H01, H05'
 'G01, H01' 'A63, G09' 'B23, F04' 'F41' 'B32, C09, C08' 'B23, B44, C03'
 'G03, B01, C40' 'C40, C07' 'C09, C08' 'B32, C04, E04, B05'
 'H01, B01, C01' 'B21, F16' 'H01, A61' 'F21, G02, G09, H01, H05' 'B65'
 'G10, H03' 'A62, B09, C02, D06' 'C08, B29, B32' 'C25, A61' 'H03' 'H02'
 'C08, B60' 'B05, B29' 'F02' 'H01, G02' 'C12, A61, C08'
 'H01, B82, C09, G01' 'B01' 'B01, F01' 'B21, F16, H02' 'G21, F16, B65'
 'C07, A01, A61' 'C08, B05, B60' 'G06, B60, B62, G08' 'B32, C21, C22'
 'F04, F24' 'G06, B41, G03, H04' 'B67' 'H01, B32' 'B65, B29' 'F23'
 'F24, F23' 'B32, C09, C22, C23' 'H01, G09, H05' 'C07, C12, A61'
 'C12, B01, B03, G01' 'B32, B21, B23, F01, F04' 'A21, A23, A47, H05'
 'H01, G11, H05' 'A61, C07, G01' 'H04, G10' 'H02, H04' 'G02, G03, B42'
 'F28' 'A61, B82' 'H01, F21' 'A61, H01, H02' 'F24, F28' 'G01, F02'
 'G01, H03' 'G06, B25, G05' 'F28, H01' 'B64, F02' 'G01, G06, G08, H04'
 'B25, G05' 'C12, G01' 'A43' 'A45' 'C30' 'H01, B82, G02, H04' 'F04, H02'
 'H01, C08, D06' 'G06, G11, H04' 'G01, G02' 'G06, G16, A61' 'C08, C09'
 'C23, B05, C08, H01' 'G02, G01' 'F02, F01' 'A01, C12' 'A01' 'B23, A61'
 'B32, B31, D21' 'C12, C07, G01, G09' 'H01, B60' 'C01, F01, F02'
 'B32, B23, C09, A61, C07' 'H01, F24' 'G01, F25' 'C03' 'A45, A46, A47'
 'A62, A45, A61' 'B60, F02' 'F03, H02' 'B24, B23, C23, E21' 'G01, B21'
 'F16, F01, F02, B60' 'F01' 'G06, G02, G09' 'F28, B23, H01' 'F16, E02'
 'B25, E01, G02' 'G09, H01' 'H02, G01' 'B64, H05' 'H02, B60'
 'H05, A45, B05, H02' 'B60, F01' 'B32, A61, B05' 'B05, A01, A62'
 'G06, A61, A63' 'G01, H05' 'B01, A61, G06, H04' 'B21, C21, F27'
 'B22, A61, C21, C22' 'G06, B60, F02' 'G06, H05' 'F27, C21, F16'
 'A47, A61' 'G01, A61, G06' 'C10, C08' 'B60, B23, B25, E21, G05'
 'H05, B23, H01' 'A45, A41, A44, B65, F41, F42' 'G01, G03, G11' 'G08, H04'
 'A44, A45, A47, E05, G07' 'A62, A61' 'B65, B01, G21' 'G21'
 'F16, F24, H01' 'F28, F16' 'G11, G06, H03, H04' 'B65, B21, B25'
 'H02, B60, H01' 'H01, B29, H04' 'F25, F28' 'F25, H01' 'E04, F03'
 'H01, G09' 'A46, A61' 'H05, G01' 'C25, C08, C09, H01' 'F21, G03'
 'C02, B01' 'F16, H05, B29' 'C04, C01' 'D01, B23, D07, G02, H01'
 'C01, B01, C08, C09' 'C07, B01, C01' 'C02, B03' 'B21, A61, C22'
 'H01, G01' 'C07, C12' 'C07, B01, C10, C08' 'B29, F28' 'B65, B41, G03'
 'H01, H02' 'F03' 'G06, G09, G16, H04' 'H05, H01' 'C08, B01' 'G05, H02'
 'B27, B23' 'H03, G06' 'B60, H02' 'H01, C23' 'C30, C12' 'C12, C07'
 'G01, G05' 'B62, B29, F16' 'B28, A61, B29' 'G05' 'F15, B01, F16, G01'
 'B62, A47, G09' 'H02, H05' 'G09, G02' 'C23, C21, C22' 'B23, B60, B62'
 'C08, B32, C07, C09, G03' 'B08, F15' 'E05, F24' 'B60, F02, F03, F24'
 'F16, B66' 'G06, G03, H04' 'C08, B32, C09' 'C23, G03, H01'
 'F01, F02, B01' 'H01, H03' 'B01, C08, C09, C10' 'G01, G08' 'G03'
 'G11, G06' 'G08' 'G06, G02, G03, H04' 'F28, B01, B82, C01, H01, H05'
 'A61, G06' 'G01, B01, H05' 'C40, C07, C12' 'H05, H03' 'E02, B63, C02'
 'A46' 'F02, H01' 'C25, H01' 'B01, C01' 'H01, D03' 'B62, F16' 'F21, H01'
 'H01, G01, H03' 'A47, B01' 'G06, G16' 'B65, A23' 'E03' 'B26' 'G06, B41'
 'B65, E01' 'G08, G01, H04' 'H01, C01' 'B32, B65' 'A41, B32, C08, C09'
 'H04, A61, G06, H02' 'B25' 'H04, G01, G06' 'A61, A23, C07, C11'
 'F04, B29, F01' 'B23, B29, B32, B65' 'G06, B60, G01, G08' 'B01, C07, C10'
 'G05, H02, H03, H05' 'H02, A47, G06, H01' 'C03, B05' 'C09, H01, C08'
 'B32, B44, G02' 'C08, A61, B29' 'G06, H04, G11' 'B23, H05' 'B32, C08'
 'B01, F23' 'F16, G05' 'H01, B81, H03' 'C01' 'G06, B60' 'B05, H01'
 'H05, H01, H02' 'B62, B25' 'B24, F26' 'H01, G11' 'C08, G03'
 'C08, B29, C09' 'F01, F16' 'B25, H01' 'C10, C07' 'H02, G02' 'A47, G05'
 'E04, F24, H01' 'G05, A61, G06' 'C02, A61, C09' 'C11' 'A61, A23, C12'
 'G05, G01, H02, H04' 'B32, C08, C09, D04' 'B25, G01, G05, H01' 'G10'
 'B63, B64, F02' 'F16, E03, G01' 'G02, F21' 'A23, B29'
 'G01, G06, G09, H04, G08' 'F16, G01' 'G08, A63, G06, G09, H04'
 'E06, B60, E05' 'F16, B62' 'G01, A61, H01' 'B44, B42' 'B29, B81, B82'
 'B41, H01' 'F04, F16' 'B41, B42, C09' 'F16, B23' 'B05, C23, F01'
 'G01, C07, A61' 'B03, B07' 'H04, B60' 'A61, B29, B82, C08' 'F16, A47'
 'E01, B23' 'C09, C02, C07, C10, C11' 'B01, C10' 'B01, C01, C22, F01'
 'A45, B62' 'F16, B21' 'B60, B62' 'B23, E06, F24, E05' 'C02, C25'
 'G01, B60, H01' 'C07, G01' 'A61, A46, G01' 'G01, A46, A61'
 'A61, G16, H04' 'D05, B60, B68' 'G06, B60, H01, H02' 'C09, H01'
 'B60, F16' 'H04, A63, G01, G06' 'F16, B32, F25' 'G06, B63, C02, E03'
 'B29, G02' 'H04, H01, H05' 'F01, B22' 'F04, A61' 'A61, H04' 'H01, F03'
 'B60, B63, G05, G06' 'B05, E03' 'F17, B60, H01' 'B01, B62, C12, F04, G01'
 'A63, A41' 'B29, B23, C09' 'G06, F16' 'H04, H01'
 'G08, A47, E03, F16, F17' 'H04, G03, G06' 'C01, B32, C08, C09' 'F15, E02'
 'B01, C01, H01, F02' 'A61, B65, G16' 'F01, F02' 'B01, G01' 'F16, E21'
 'H04, G01, B63' 'E05, B64' 'E05, B23' 'A61, G06, G08' 'B32, C08, C09'
 'G05, A61' 'H04, G04' 'H01, B05, C08' 'H01, C08, C09' 'B42' 'F16, B61'
 'B60, B29' 'B64, F16, G01' 'C09, G02' 'G01, D01' 'E05, H05'
 'F02, B05, F23' 'A44' 'F24' 'B05, B32, E04' 'H02, A61'
 'H01, C01, C23, G11' 'G06, G09, H03' 'B32, B29, G03' 'G05, G06'
 'B32, H01' 'F16, H02' 'B64, B29' 'B61, B60' 'H01, C08, C09, H05'
 'B01, C07, C08' 'B60, F21' 'B05, A62, B29, F28' 'B65, H04, H02'
 'G06, A61, G16' 'B01, H01' 'G02, H04' 'H05, G02, H04' 'B01, C08, C09'
 'B29, C09, H01, C08' 'G03, C03, G02, G06' 'F16, A45, B62, E04, G05'
 'H02, H01, H04' 'C23' 'C22, C21' 'B60, G01, G06' 'G11, G09, H03' 'B24'
 'A47, G07, B07' 'H01, B60, E05, G07, H04' 'G01, A61' 'F16, B05, E03'
 'C04' 'F16, F15' 'B32, C09' 'H05, G06' 'B25, B23' 'B62, A61, B60'
 'G06, H03' 'F03, F04' 'B82, C08, C09, H01' 'G09, H05' 'B66, B60'
 'F01, B01' 'G02, B81, H02' 'A61, B29' 'B60, G08' 'G01, B60, B62'
 'C08, B29' 'G01, A45, A61' 'G01, B60, H04' 'B60, G05, G06' 'C09, C04'
 'F16, A61, B25, G05' 'G01, F01' 'C07, H01' 'B23, F16' 'B05, B41, H05'
 'C08, B32' 'B65, B67, F16' 'H04, G08' 'G05, B62, A63' 'G06, H01'
 'G01, G05, H02, H03' 'B32' 'F21, G09, G01' 'G01, B01, G21'
 'B32, A62, B01, C07' 'H02, B60, H01, G01' 'G11' 'H03, G02' 'G06, A63'
 'B01, F02' 'G11, G01' 'G05, G08' 'A46, A45' 'F02, B62, F03, H02'
 'B05, F24' 'B64, B63' 'B01, F16' 'H01, F25' 'B65, B60, F16, H02'
 'B32, E04' 'H02, G11, F16' 'G01, G06, H02' 'F16, F01, F04' 'B65, B26'
 'E01' 'C09, C30, G01, G21' 'C12, B82, C01, G01, H01' 'G08, G06, H04'
 'G06, H01, H02, H05' 'G02, G03, H04' 'C23, B21, B65' 'C08, A61'
 'B65, B60' 'B65, F17' 'H04, G01, G03' 'H01, B81' 'F02, F01, F04'
 'F24, G05' 'F24, H05' 'B07' 'B01, C02, F04' 'G01, G06, H05' 'G09, G11'
 'H04, H05, G09' 'G01, G06, H01' 'H01, G01, H02' 'G05, F24, H05'
 'G02, B29' 'F16, B05' 'C08, H05' 'H01, C09' 'B22' 'B65, B62, F16'
 'C08, A61, C09' 'G11, F16, H02' 'F23, C11, F21' 'G01, H01, H04'
 'B60, E02, F02, G06' 'G06, B64' 'B65, B31' 'G06, B60, G08' 'C02, C22'
 'G06, F15, G11' 'B05, C09, D06, C08' 'H03, G10, H04' 'G11, G06, H03'
 'F16, F01' 'A61, B01, C01' 'C08, C09, H01' 'C08, H01'
 'B01, B05, B29, B82, C02, F04' 'G08, B82, G02, H01' 'G06, B60, G01'
 'A23, C07' 'B01, B82, C01' 'G01, H04, G02' 'G05, B60' 'B01, B81'
 'B08, A61, B05, B65, F02, F16, F26' 'G02, B32' 'E06' 'A41, A44, B63'
 'E06, E04' 'E21, B22, C22' 'C01, C07, C09, H01, H05' 'H01, G03, H04'
 'H05, H02' 'A61, H01' 'C09, B05, B82, C30, H01' 'C02, E02, F17'
 'F03, B64, H02' 'G06, G01, G11' 'F03, F02' 'A01, B63, E04, F16'
 'G06, G01, G05' 'H01, G05, G07' 'B01, A61' 'H02, B60, H03'
 'H02, G11, H01' 'H04, G06, G08' 'H05, H04' 'F01, E02, F02, F15'
 'G05, G06, H02' 'G05, G06, G07, H04' 'G01, G10' 'G10, H04, H03'
 'C10, F21, F23' 'G09, H04' 'B21, B23, C22' 'B21, B23, F16, B29'
 'A61, B82, C08' 'A61, F21, G02, H05' 'C07, B01, C10' 'G06, G11, H01'
 'F04, F01, F15' 'G10, A61, B60, G01, G05, G06, H04' 'B08, A61, C02'
 'G02, B32, C09, H04, B82' 'A61, G02' 'B01, C07' 'F04' 'B62, G01, H02'
 'G02, C07' 'C23, H01' 'H01, B81, G01, H04' 'H04, H03, G07' 'G01, B25'
 'F16, F01, F02, F03, F04' 'B23, C22' 'A61, A01, A62, B05, E01, A45'
 'F04, F24, G01' 'G09, G01, G02, G06, B60' 'B62, B60, H05' 'B62'
 'C08, B29, B32, C09' 'C01, H01' 'H04, G02, G03' 'D02, A44, D04'
 'H02, G01, H01' 'B23, B29, B62, B60' 'G11, B82, H01' 'B01, H01, F24'
 'B32, B21, B60, B62, E04' 'C12, A61, G01' 'B65, A47, G01' 'E21, H01'
 'H01, E04, F16' 'F03, F01' 'B29, D07' 'G05, B61'
 'G01, A61, C07, C08, C12' 'B05, B23, C22, C23, G11' 'F16, F01, F02'
 'C07, C08, C11, C02' 'F01, B01, C01, H01' 'B41, C09' 'B23, G01, G06, H01'
 'E21, B66' 'G04, F16' 'G01, B60' 'G03, G02' 'G06, D21' 'C22, B21, C21'
 'F02, B63, F01' 'B60, B62, F01' 'A47, A46, A63' 'B23, B24' 'H01, H04'
 'B29, B32, D01' 'G03, C07' 'B60, D03' 'G02, H01' 'B29, C08' 'H01, G03'
 'H05, F24, H01, H02' 'H05, B41' 'B23, G05' 'G01, F01, F04, G06'
 'B22, H01' 'B23, E04, B32, G10' 'B01, B03' 'B23, B21' 'C02' 'H05, E05'
 'B07, B43' 'G06, B26, B41, G05' 'B29, F16' 'F16, A61, B32, D04'
 'G01, G06' 'B21, F28' 'B23, B64, B25' 'G09, G05, G06' 'B60, F01, F04'
 'H01, G05' 'G03, G02, H01' 'F21, G02' 'F04, B01, C10, C25, F15, F25'
 'H01, B08' 'B01, F01, F02' 'F01, B60, F02' 'A44, B64'
 'C07, B82, C01, C09' 'H01, C01, C03' 'F21, G02, G03, H01' 'G06, G05, H02'
 'A61, B08' 'B62, B65' 'G06, G09, H01' 'G06, G01, G07, H01'
 'B05, C08, C09, G03' 'C04, B22, B29, B32, C22, F21, F28, H01' 'G08, G01'
 'F21, H05, H01' 'G06, B25, B66, C03' 'H01, B23'
 'B32, A44, A47, B23, E04, F16' 'B64, F02, H01' 'G05, H05' 'E02' 'C09'
 'C08, B05, C09' 'F16, E02, F15' 'E04, A62' 'C10, C08, F17' 'B05, F16'
 'H01, B82, G02, G03' 'G01, H02' 'B68, A47' 'G02, F21, H04, G09'
 'G06, G05, G08, H02' 'H01, G06' 'H01, B81, G01' 'C04, B01, B22'
 'F21, G09' 'C01, B82, C09, C12, G01' 'F16, A47, B23' 'A63, G06, G07'
 'F16, F02' 'B65, A45, G06' 'B41, B65' 'G08, G04, H04' 'B01, H05'
 'B32, B29, C08' 'A62, A61, G02, G03, H04' 'F02, B01' 'F21, B60'
 'H04, G06, G09' 'E02, B67, E03, E04' 'G01, G05, G06, F24' 'G07, E05'
 'G02, H05' 'B60, A63' 'B01, B23, C10' 'F02, B62' 'C10, B01' 'A47, B65'
 'G02, B41, G03' 'G01, G16, F03' 'B60, B23' 'B32, H05'
 'G01, F16, G06, F01' 'G06, B60, G05' 'H02, G06, H04, H05' 'G02, G03, H01'
 'G02, H01, H04' 'H01, B32, C04, C09' 'H05, B29, H01' 'H04, G01, G06, G08'
 'B60, H05' 'H04, G06, G01' 'F15, F16' 'F02, F01, H02' 'G01, G03'
 'B60, E05' 'G06, F28, H05' 'B65, A61' 'G08, A01' 'G02, B32, C08, C09'
 'G06, B32, D06' 'G06, A61, G05' 'H04, G06, G07' 'B60, A47, B62, B67'
 'B65, B61' 'G01, F16' 'G21, G01, G03, H01, H05' 'A47, A01'
 'C03, C08, C09, H01' 'B60, G05, H04' 'G06, B62, B60, G01' 'B01, C25'
 'C22, C25' 'G06, G10' 'B81, G01' 'G03, B65' 'G06, B25, H01'
 'G03, G02, H04' 'B63' 'G11, H02' 'H01, H05, H02' 'G06, B25'
 'G06, G01, H03' 'G01, B41' 'F01, C22, C23' 'H01, C01, C04' 'B41, H05'
 'B23, B06, H01' 'A61, A63' 'E04, E02, E06' 'E21' 'B03, B01, C10'
 'A61, H05' 'G06, G05' 'A47, G07' 'B05, E04' 'B65, B41' 'B41, G03'
 'B60, E05, G05' 'E04, E01' 'H04, H05' 'C07, C10' 'H02, G01, G08'
 'G02, F21, F24, H01' 'A63, B29' 'A01, A23' 'A01, A23, C12' 'C25'
 'G05, H04, B64, G07' 'H01, B81, H02, H04' 'B65, B66, E04' 'B25, A61'
 'A61, A45' 'B65, H04' 'A61, B60' 'B02' 'B27' 'A47, A45'
 'A47, A45, B62, B65, F25' 'B32, A61, B65' 'B23, C25' 'B82, B26, G01'
 'A61, A01, C11' 'G02, F16, G01' 'F03, B64' 'G05, G07' 'G08, G05, G06'
 'G02, G09, H04' 'H04, G09' 'H04, H01, H03' 'G06, A01, A61'
 'G06, H04, G09' 'C12, A61, C07']


CPC Class
['B08, A47' 'B64, F01, F16, G01, H02, Y10' 'A61' ... 'G06, G07'
 'H04, G06, Y02' 'G06, G11, H03']


US Class - Original
['134105' '416145 | 0745741 | 310081'
 '424046 | 424489 | 424490 | 424493 | 424499 | 514951' ...
 '4353201 | 53602372 | 5360241' '606257 | 606264'
 '5140178 | 514034 | 514183 | 51425217 | 514557 | 435029 | 435366 | 435004 | 43500724']


Cited Refs - Patent
['CN2544162Y | US7516565B1 | CN2741495Y | US5609047A | US6295691B1 | US20050274403A1 | CN101022898A | JP2001327449A | WO2008012661A2 | WO2001021054A1 | WO2006014311A1 | CN2639658Y | CN2644027Y | EP1223844A1 | JP9154569A | KR2007119256A | CN2577987Y | DE202004014412U1 | US20060000049A1 | CN2389017Y | CN1500565A | JP2003526489A | US7237409B2 | EP719516A2 | JP58156587U | KR2007016449A | US7475448B2 | US20050125934A1 | CN1439836A | DE2004014412U1 | US3000036A | US20030145880A1 | US20050161538A1 | US20110073135A1 | CN2568904Y | CN2689033Y'
 'US4326158A | US5310137A | US5757662A | US6907800B1 | US7958801B2 | US4953098A | US5676025A | US7350749B2 | US4728837A | US2664763A | US4901573A | US5586505A | US6568291B1 | US7047109B2 | US20090180882A1 | US7492074B1 | US4218187A | US5497861A | US7942633B2 | US20050079056A1 | US3219120A | US5553514A | US6236934B1 | US4951514A | US5831354A | US6210099B1 | US7267029B2 | US7722322B2 | US20010035068A1 | US20090116963A1 | JP61164109A | US20060083617A1 | US3538469A | US5372478A'
 'US6521260B1 | US7744855B2 | WO1995000127A1 | ZA199400155A | EP239798A1 | WO1995011666A1 | GB1242211A | US7718163B2 | US20030185764A1 | US2533065A | US5478578A | WO1994013271A1 | WO1987005213A1 | EP20072979A1 | EP124493A2 | US6153224A | GB2269992A | WO1991014422A1 | GB905723A | GB1310527A | GB786499A | US6884794B2 | US5376386A | WO1994004133A1 | GB1230087A | GB2240337A | GB95219374X | WO1993011746A1 | WO1991011173A1 | EP2213279A2 | US7223748B2 | US7541022B2 | US5642728A | WO1995000128A1 | WO1996023485A1 | SE9203743A | GB1242212A | US3957965A | GB1381872A | EP187433A1 | GB1132583A | EP1283160A1 | US7011818B2 | US5506203A | US20030133880A1 | US5972388A | ZA199400155B | WO1992008447A1 | EP606486A1 | EP100751197A1 | US20030175214A1 | GB95219374A | ZA94155B | SE92037431B'
 ... 'US7195896B2 | US5994132A | WO1997016547A1'
 'US6641583B2 | US6613053B1 | US6287309B1'
 'US6147094A | US6264994B1 | JP1997221421A | JP2000290184A | WO2000019200A1 | WO2001012236A2 | WO2001056982A1 | WO2002073212A2 | WO2003083067A2 | JP9221421A | WO1998051702A1 | WO1999037294A2 | WO2001000619A1 | US5922761A | WO1998047854A1 | US5663201A | WO1993011762A1 | WO1996009299A1 | WO1998009523A1 | WO2001051464A1 | WO1994000095A2 | WO1998025887A2 | WO1999048489A2 | US7842455B2 | EP778023A1 | US6187950B1 | EP1006108A1 | EP1239038A1 | GB2314268A | WO1998002435A1 | WO2001010829A1 | WO2004002488A1 | US5846984A | US8137916B2 | US8343926B2']


Cited Refs - Non-patent
['Evaluation Report for Chinese Application No. 201020138464.6. |  Novelty Evaluation Report for Chinese Application No. 201020138464.6. |  Chinese Office Action for CN 201010127191.0 mailed Aug. 2, 2012. |  Report of Utility Model Technical Opinion for JP 2010-001169 mailed Jun. 15, 2011. |  International Search Report and Written Opinion for PCT/US2010/048043 mailed May 26, 2011. |  International Preliminary Report on Patentability for PCT/US2010/048043 mailed Apr. 5, 2012.'
 "Kayler, Kimberly. \x93LORD Corporation's Technology to be Presented at American Helicopter Society's Annual Forum 67.\x94 Apr. 28, 2011. Retrieved from <http://www.lord.com/News-Center/News-Stories/LORD-Technology-Presented-at-American-Helicopter-Societys-Annual-Forum-67.xml>. |  Anonymous. \x93Carolina Transparency: Dual Frequency Hub-Mounted Vibration Suppressor.\x94 Date unknown. Retrieved from <http://www.carolinatransparency.com/earmarks/popup.php?id=62098>. Retrieved Sep. 21, 2011. |  Kayler, Kimberly. \x93LORD Selected to Team with Sikorsky for Hub-Mounted Vibration.\x94 Jan. 29, 2009. Retrieved from <http://www.lord.com/News-Center/Press-Releases/LORD-Selected-to-Team-with-Sikorsky-for-Hub-Mounted-Vibration-Suppression-(HMVS).xml>."
 'Ahmed \x93Particle Interactions in Multicomponent Systems.\x94 (Ph.D. Thesis, University of bath, 1989), pp. 1-376. |  Ganderton. \x93The Generation of Respirable clouds form coarse powder aggregates.\x94 Journal of Biopharmaceutical Sciences. vol. 3 (1/2), 1992, pp. 101-105. |  Kassem. \x93Generation of Deeply Inspirable clouds from dry powder mixtures.\x94 Ph. D. Thesis. Department of Pharmacy. Kings College, University of London, 1990. pp. 1-275. |  Glaxo Opposition Against European Patent 1232745 in the Name of Vectura Limited, Aug. 24, 2009. |  Norton Opposition Against European Patent No. 1 232 745, Norton Healthcare Ltd. Aug. 2009. |  European Search Report\x97Corresponding application No. EP 06 08 4066. Mailed Mar. 26, 2009. |  AstraZeneca AB Notice of Opposition against European Patent No. 1 666 023 in the name of Vectura Limited, filed Jul. 4, 2012. |  Staniforth, J. et al. \x93Interparticle forces in binary and ternary ordered powder mixes\x94, J. Pharm. Pharmacol., vol. 34, 1982, pp. 141-145. 15 |  Brindley et al., Design, Manufacture and Dose Consistenty of the Serevent Diskus Inhaler, Pharmaceutical Technology Europe, Jan. 1995, seven pages. |  Rowe et al., Handbook of Pharmaceutical Excipients, Royal Pharmaceutical Society of Great Britain, Fifth Edition, Pharmaceutical Press, 2007 pp. 389-395. |  Extended European Search Report for corresponding European Patent Application No. 10075119.7 mailed Aug. 25, 2010. |  Reply to Grounds of Appeal for corresponding European Patent No. 1232745, Oct. 8, 2010. |  Zeng, X. et al. \x93Particulate Interactions in Dry Powder Formulations for Inhalation\x94, Taylor & Francis, London & New York, 2001, pp. 220-224.'
 ...
 "Nokia 9000i, \x93User's Manual, \x94 (1995-1997). |  Nokia, \x93Nokia 9000 Communicator, User's Manual, \x94 (1995). |  Nokia, \x93First GSM-based communicator product hits the market. Nokia Starts Sales of the Nokia 9000 Communicator, \x94 Press Release (1996). |  Nokia, \x93Nokia introduces the new Nokia 9000i Communicator for GSM Markets, \x94 Press Release (1997)."
 'Bhat et al., 1987, EMBO Journal, vol. 6, No. 7, p. 2045-2052. 3 |  Wickham et al., 2003, US 20030099619 A1. |  Goding, C.R., Temperley, S.M., and Fisher, F., \x93Multiple transcription factors interact with the adenovirus-2 Ell-late promoter: evidence for a novel CCAAT recognition factor, \x94 Nucleic Acids Research, vol. 15, No. 19, IRL Press Limited, Oxford, England, 1987. DOI:10.1093/nar/15.19.7761 1 |  Huang et al., Gene Therapy, 10, 1241-1247 (2003). DOI:10.1038/sj.gt.3301987'
 "Arendt, Th. et al., \x93Neuroprotection by Repressing G0-G1 Transition: A Therapeutic Strategy for AD?\x94 Eur. J. Neuroscience 12(Supplement 11):552 TWH 4 (2000). 5 |  Chyan, C.J. et al., \x93Neuroprotective Activity of Melatonin Against Alzheimer Beta-Amyloid is Not Mediated by Melatonin Receptors\x94, Society of Neuroscience Abstracts, vol. 24(1/2):1455 (1998). |  Copani, A., et al., \x93Mitotic Signaling by Beta-Amyloid Causes Neuronal Death, \x94 FASEB J. 13/15:2225-2234, (1999). 12 |  Crapper Mclachlan, D.R. et al., \x93Intramuscular Desferrioxamine in Patients With Alzheimer's Disease, \x94 The Lancet 337(8573):1304-1308, (1991). DOI:10.1016/0140-6736(91)92978-B 22 |  Database WPI Week 199744, Derwent, AN 1997-475453 & JP 09 221421 (Kyowa Hakko Kogyo KK) (Aug. 26, 1997). |  Database WPI Week 200114, Derwent, AN 2001-127322 & JP 2000 290184 (Kyowa Hakko Kogyo KK) (Oct. 17, 2000). |  European Search Report EP 06025392 (Jun. 13, 2007) pp. 1-23. |  European Search Report EP 06025393 (Apr. 26, 2007) pp. 1-12. |  European Search Report EP 06025394 (May 30, 3007) pp. 1-8. |  Giovanni, A. \x93Involvement of Cell Cycle Elements, Cyclin-dependent Kinases, pRv, and E2F.DP, in B-amyloid-induced Neuronal Death, \x94 J. Biol. Chem. 274(27):19011-19016 (1999). DOI:10.1074/jbc.274.27.19011 3 |  Giovanni, A \x93E2F1 Mediates Death of B-amyloid-treated Cortical Neurons in a Manner Independent of p53 and Dependent on Bax and Caspase 3\x94, J. Biol. Chem. 275(16):11553-11560, (2000). DOI:10.1074/jbc.275.16.11553 4 |  Howlett, D.R., \x93Common Structural Features Determine the Effectiveness of Carvedilo, Daunomycin and Rolitetracycline As Inhibitors of Alzeheimer B-Amyloid Fibril Formation, \x94 Biochem. J. 343, pp. 419-423, 1999. DOI:10.1042/0264-6021:3430419 7 |  Israel, C.W. et al., \x93Discrimination Between Ventricular and Supraventricular Tachycardia by Dual Chamber Cardioverter Defibrillators: Importance of the Atrial Sensing Function, \x94J. Pacing and Clinical Electrophysiology, 24(2):183-190, 2001. DOI:10.1046/j.1460-9592.2001.00183.x  |  Janicki, S.M. et. al., \x93Presenilin Overexpression Arrests Cells in the G1 Phase of the Cell Cycle, Arrest Potentiated by the Alzheimer's Disease PS2(N1411) Mutant, \x94 Amer. J. Pathology 155(1):135-144, (1999). DOI:10.1016/S0002-9440(10)65108-5 6 |  Kwada, M. et al., \x93A Novel Antitumor Compound, Reduces Cyclin D1 Levels, Arrests Cell Cycle At G1 Phase, and Inhibits Anchorage-Independent Growth of Human Tumor Cells, \x94 Exper. Cell. Res. 249(2), 240-247, (1999). DOI:10.1006/excr.1999.4467  |  Lazarovici, P. et al., \x93K252a and Staurosoporine Microbial Alkaloid Toxins As Prototype of Neurotropic Drugs, \x94 Advances in Experimental Medicine & Biology, 391(31):367-377, (1996).  |  Liu, D.X. et al., \x93Neuronal apoptosis at the GI/S cell cycle checkpoint, \x94 Cell Tissue Res., 305:217-228, (2001). DOI:10.1007/s004410100396  |  Nagy, Z. et al., \x93Cell Cycle Markers in the Hippocampus in Alzheimer's Disease, \x94 Acta Neuropathol. 94:6-15 (1997).  |  Nagy, Z., et al., \x93Expression of Cell Division Markers in the Hippocampus in Alzheimer's Disease and Other Neurodegenerative Conditions, \x94 Acta Neuropathol. 93:294-300 (1997).  |  Nagy, Z., et al., \x93The Cell Division Cycle and the Pathophysiology of Alzheimer's Disease, \x94 Neuroscience 87(4):731-739 (1998). 10 |  Nagy, Z. et al., \x93Cell Cycle Regulation in Alzheimer's Disease, \x94 Eur. J. Neuroscience 12(Supplement 11):552 TWH 3 (2000). |  Nagy, Z. \x93Cell Cycle Regulatory Failure in Neurones: Causes and Consequences, \x94 Neurobiology of Aging 21:761-769 (2000). DOI:10.1016/S0197-4580(00)00223-2  |  Nagy, Z. et al., \x93Cell Cycle Kinesis in Lymphocytes in the Diagnosis of Alzheimer's Disease, \x94 Neuroscience Lett. 317:81-84 (2002). DOI:10.1016/S0304-3940(01)02442-9  |  Nagy, Z. \x93The Last Neuronal Division: A Unifying Hypothesis for the Pathogenesis of Alzheimer's Disease, \x94 J. Cell. Mol. Biol. 9(3):531-541 (2005). DOI:10.1111/j.1582-4934.2005.tb00485.x 1 |  Nagy, Z. \x93The Dysregulation of the Cell Cycle and the Diagnosis of Alzheimer's Disease, \x94 Biochimica Biophs. Acta 1772:402-408 (2007). DOI:10.1016/j.bbadis.2006.11.001 2 |  Nakai, M. et al., \x93PKC and Tyrosine Kinase Involvement in Amyloid (25-35)-Induced Chemotaxis of Microglia, \x94 Neuroreport Rapid Communications of Oxford 9(15):467-3470, (1998). DOI:10.1097/00001756-199810260-00024  |  Nitsch, R.M. \x93Vasopressin and Bradykinin Regulate Secretory Processing of the Amyloid Protein Precursor of Alzheimer's Disease, \x94 Neurochemical Research 23(5):807-814, (1998). DOI:10.1023/A:1022423813362  |  Pappolla, M.A. \x93Melatonin Prevents Death of Neuroblastoma Cells Exposed to the Alzheimer Amyloid Peptide, \x94 J. Neuroscience 17(5):1683-1690, (1997).  |  Racchi, M. et al., \x93Bradykinin-Induced Amyloid Precursor Protein Secretion in Fibroblasts from Alzheimer's Disease Down's Syndrome and Control Donors\x94, Society of Neuroscience Abstracts, 22(1-3):1944 (1996). |  Regenold, W.T., \x93Uses of Intravenous Valproate in Geriatric Psychiatry, \x94 Am J. Geriatric Psychiatry, 9(3):306-308, (2001). DOI:10.1176/appi.ajgp.9.3.306  |  Sival, R.C. et al., \x93The Effects of Sodium Valproate on Disturbed Behavior in Dementia\x94, J. Amer. Geriatrics Soc. 42(8):906-907 (1994).  |  Takahashi, M. et al., \x93Shorei Hokoku Valproic Acid Natrium . . . , \x94 Brain and Nerve, 48(8):757-760 (1996). |  Nagy, Z. (2007) \x93The Dysregulation of the Cell Cycle and the Diagnosis of Alzheimer's Disease, \x94 Biochimica et Biophysica Acta 1772:402-408. DOI:10.1016/j.bbadis.2006.11.001  |  Ueberham, U. et al. (2005) \x93The Expression of Cell Cycle Proteins in Neurons and its Relevance for Alzheimer's Disease, \x94 CNS & Neurological Disorders 4:293-306. |  Wang, Z. et al. (2014) \x93Valproic Acid Reduces Neuritic Plaque Formation and Improves Learning Deficits in APPSwe/PSIA246E Transgenic Mice via Preventing the Prenatal Hypoxia-Induced Down-Regulation of Neprilysin, \x94 CNS Neuroscience & Therapeutics 20:209-217. DOI:10.1111/cns.12186  |  Zhang, X.-Z. et al. (2010) \x93Valproic Acid As a Promising Agent to Combat Alzheimer's Disease, \x94 Brain Research Bulletin 81:3-6. DOI:10.1016/j.brainresbull.2009.09.003"]


Citing Patents
['US20160128536A1 | US20160128537A1 | US9549651B2 | US9549652B2 | USD806333S1'
 'US10167079B2 | US10308355B2 | US10400851B2 | US10443674B2 | US10443675B2 | US10527123B2 | US10543910B2 | US10619698B2 | US10654565B2 | US10717521B2 | US10822076B2 | US10974822B2 | US11021241B2 | US11040770B2 | US11396369B2 | US11440650B2 | US11472540B2 | US11555528B2 | US20160325828A1 | US9212559B2 | WO2018187178A1 | WO2019005249A1 | WO2019005250A1'
 'US10561613B2 | US20160243039A1 | WO2022047047A1' ...
 'EP3556845A1 | RU2636890C2 | US10012636B2 | US10067121B2 | US10168318B2 | US10215748B2 | US10239058B2 | US10533985B2 | US10539523B2 | US10551371B2 | US10620188B2 | US10690677B2 | US10725023B2 | US10799865B2 | US11007520B2 | US11103870B2 | US11220671B2 | US11273177B2 | US11346797B2 | US11360072B2 | US11365381B2 | US11604197B2 | US9399787B2 | US9612234B2 | US9625472B2 | USD941488S1'
 'US10155930B2 | US10300096B2 | US10731136B2 | US11268073B2'
 'US10188528B2 | US10350088B2 | US10398574B2 | US20150182264A1 | US20170196596A1 | US9549766B2 | US9763699B2 | US9987044B2']


INPADOC Legal Status
['2022-06-30 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY FEE PAYMENT YEAR 8 |  2020-04-03 AS ASSIGNMENT COMPASS CAYMAN SPV 2 LIMITED, MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT;REEL/FRAME:052311/0585 2020-04-02 |  2020-04-03 AS ASSIGNMENT COMPASS CAYMAN SPV, LTD., MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT;REEL/FRAME:052311/0585 2020-04-02 |  2020-04-03 AS ASSIGNMENT EP MIDCO LLC, MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT;REEL/FRAME:052311/0585 2020-04-02 |  2020-04-03 AS ASSIGNMENT EURO-PRO HOLDCO, LLC, MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT;REEL/FRAME:052311/0585 2020-04-02 |  2020-04-03 AS ASSIGNMENT GLOBAL APPLIANCE INC., MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT;REEL/FRAME:052311/0585 2020-04-02 |  2020-04-03 AS ASSIGNMENT GLOBAL APPLIANCE UK HOLDCO LIMITED, MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT;REEL/FRAME:052311/0585 2020-04-02 |  2020-04-03 AS ASSIGNMENT SHARKNINJA MANAGEMENT COMPANY, MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT;REEL/FRAME:052311/0585 2020-04-02 |  2020-04-03 AS ASSIGNMENT SHARKNINJA OPERATING LLC, MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT;REEL/FRAME:052311/0585 2020-04-02 |  2020-04-03 AS ASSIGNMENT SHARKNINJA SALES COMPANY, MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT;REEL/FRAME:052311/0585 2020-04-02 |  2018-07-02 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 |  2017-10-13 AS ASSIGNMENT SHARKNINJA OPERATING LLC, MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:BANK OF AMERICA, N.A.;REEL/FRAME:044207/0652 2017-09-29 |  2017-10-03 AS ASSIGNMENT JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT SECURITY INTEREST;ASSIGNORS:GLOBAL APPLIANCE INC.;SHARKNINJA OPERATING LLC;SHARKNINJA MANAGEMENT COMPANY;AND OTHERS;REEL/FRAME:044321/0885 2017-09-29 |  2017-10-03 AS ASSIGNMENT JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT, NEW YORK SECURITY INTEREST;ASSIGNORS:GLOBAL APPLIANCE INC.;SHARKNINJA OPERATING LLC;SHARKNINJA MANAGEMENT COMPANY;AND OTHERS;REEL/FRAME:044321/0885 2017-09-29 |  2015-11-17 AS ASSIGNMENT BANK OF AMERICA, N.A., AS AGENT, MASSACHUSETTS FOURTH SUPPLEMENT TO PATENT SECURITY AGREEMENT;ASSIGNOR:SHARKNINJA OPERATING LLC;REEL/FRAME:037124/0386 2015-08-25 |  2015-08-12 AS ASSIGNMENT SHARKNINJA OPERATING LLC, MASSACHUSETTS CHANGE OF NAME;ASSIGNOR:EURO-PRO OPERATING LLC;REEL/FRAME:036333/0287 2015-07-13 |  2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE |  2012-11-16 AS ASSIGNMENT EURO-PRO OPERATING, LLC, MASSACHUSETTS ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:BREIT, OLIVER RUDOLPH;REEL/FRAME:029309/0231 2010-02-22'
 '2022-06-30 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY FEE PAYMENT YEAR 8 |  2018-07-02 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 |  2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE'
 '2019-02-26 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2018-12-30 |  2019-02-04 STCH INFORMATION ON STATUS: PATENT DISCONTINUATION - PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 |  2019-02-04 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY |  2018-08-13 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY'
 ...
 '2022-06-30 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY FEE PAYMENT YEAR 8 |  2018-01-02 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 |  2015-05-05 AS ASSIGNMENT TECHNISCHE UNIVERSITAET MUENCHEN, GERMANY ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:HOLM, PER SONNE;REEL/FRAME:035565/0133 2014-11-14 |  2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE'
 '2022-06-15 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY FEE PAYMENT YEAR 8 |  2018-06-14 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 |  2018-03-19 FEPP FEE PAYMENT PROCEDURE ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: BIG.) |  2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE |  2013-05-23 AS ASSIGNMENT LDR MEDICAL, FRANCE ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:DELECRIN, JOEL;ALLAIN, JEROME;TROPIANO, PATRCIK;AND OTHERS;SIGNING DATES FROM 20040329 TO 20040624;REEL/FRAME:030477/0152'
 '2019-02-26 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2018-12-30 |  2019-02-04 STCH INFORMATION ON STATUS: PATENT DISCONTINUATION - PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 |  2019-02-04 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY |  2018-08-13 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY |  2016-08-02 AS ASSIGNMENT OXFORD UNIVERSITY INNOVATION LIMITED, GREAT BRITAI CHANGE OF NAME;ASSIGNOR:ISIS INNOVATION LIMITED;REEL/FRAME:039550/0045 2016-06-16 |  2016-08-02 AS ASSIGNMENT OXFORD UNIVERSITY INNOVATION LIMITED, GREAT BRITAIN CHANGE OF NAME;ASSIGNOR:ISIS INNOVATION LIMITED;REEL/FRAME:039550/0045 2016-06-16 |  2015-04-21 CC CERTIFICATE OF CORRECTION |  2014-11-21 AS ASSIGNMENT ISIS INNOVATION LIMITED, UNITED KINGDOM ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:NAGY, ZSUZSANNA;REEL/FRAME:034232/0725 2002-09-05']


INPADOC Family Members
['US8919357B2 | CN102029266A | CN102029266B | CN201625643U | JP03160354U | US20110073135A1 | US20130160803A1 | WO2011037744A2 | WO2011037744A3'
 'US8920125B2 | US20090236468A1 | US20130164132A1 | US8403643B2'
 'US8920781B2 | AT256450T | AT355822T | AT526946T | AU199645456A | AU699131B | BG101858A | BR199607490A | BRPI9607490B8 | BRPI9612950B1 | BRPI9612950B8 | CA2211874A1 | CA2211874C | CN1179097A | CN1303974C | CZ199702443A3 | CZ294259B6 | DE69631119D1 | DE69631119T2 | DE69636961D1 | DE69636961T2 | DK1232745T3 | DK1666023T3 | DK806938T3 | EA20199700153A1 | EA352B1 | EE199700176A | EP1159955A1 | EP1232745A1 | EP1232745B1 | EP1666023A2 | EP1666023A3 | EP1666023B1 | EP2213279A2 | EP2213279A3 | EP2258342A2 | EP2258342A3 | EP806938A1 | EP806938B1 | ES2213172T3 | ES2278828T3 | ES2375007T3 | FI119676B | FI199703151A0 | FI199703151A | FI973151A0 | GB199501841D0 | GB199521937D0 | GEP199901687B | HK1084897A1 | HU199802209A2 | HU199802209A3 | HU229965B1 | IS4531A | JP04042867B2 | JP10513174A | KR1998701844A | KR500694B1 | MX199705847A | NO199703502A | NO199703502D0 | NO324037B1 | NZ300654A | PL186757B1 | PL321572A1 | PT1232745E | PT1666023E | PT806938E | SI1232745T1 | SI1666023T1 | SK199701036A3 | SK282630B6 | TR199700722T1 | UA61051C2 | US20030170183A1 | US20060029552A1 | US20100330188A1 | US6153224A | US6521260B1 | US7011818B2 | US7718163B2 | WO1996023485A1 | ZA199600721B'
 ...
 'US8921100B2 | AT500338T | AU2002350545A1 | CA2466889A1 | CA2466889C | DE10150984A1 | DE50214936D1 | EP1436403A2 | EP1436403B1 | JP04402457B2 | JP2005505299A | KR1015772B1 | KR2004054719A | KR2009127361A | US20070116670A1 | US20100015700A1 | US7572633B2 | WO2003033692A2 | WO2003033692A3'
 'US8920474B2 | EP1435861A1 | EP1435861B1 | ES2387480T3 | FR2831049A1 | FR2831049B1 | US20050010215A1 | US20120265248A1 | US20150182264A1 | US20170196596A1 | US8162988B2 | US9549766B2 | US9987044B2 | WO2003032851A1'
 'US8921321B2 | AT481093T | AT524169T | AT535236T | DE60237725D1 | EP1408938A1 | EP1764092A2 | EP1764092A3 | EP1764092B1 | EP1767197A2 | EP1767197A3 | EP1767197B1 | EP1769791A2 | EP1769791A3 | EP1769791B1 | EP2286803A1 | EP2286875A1 | EP2289511A1 | EP2292238A1 | EP2292240A1 | ES2352964T3 | ES2373565T3 | ES2375293T3 | GB200117645D0 | US20030032673A1 | US20130102553A1 | US8343926B2 | WO2003007925A1']


INPADOC Family ID
['20100624JP03160354U_' '20090924US20090236468A1' '19950322GB199501841D0'
 ... '20030417DE10150984A1' '20030424WO2003032851A1'
 '20010912GB200117645D0']


In [21]:
for i in obj_cols:
    print(i)
    print(df[i].value_counts())
    print('\n')
Publication Number
US8919357B2    1
US8921157B2    1
US8919110B2    1
US8920467B2    1
US8922204B2    1
              ..
US8921297B2    1
US8921364B2    1
US8921060B2    1
US8921502B2    1
US8921321B2    1
Name: Publication Number, Length: 2784, dtype: int64


Title
Semiconductor device                                                          7
Light emitting device                                                         4
Display device                                                                3
User interface system                                                         3
Liquid crystal display device                                                 3
                                                                             ..
Photo-responsive layer and layer assembly                                     1
Stable sustainable hand dish-washing detergents                               1
Modulators of calcium release-activated calcium channel                       1
Health-beneficial preparation and production method                           1
Therapeutic strategies for prevention and treatment of alzheimer's disease    1
Name: Title, Length: 2756, dtype: int64


Priority Number
US2009567718A                                                                                                   1
JP201167147A                                                                                                    1
GB20093262A | GB200922612A | US2010712681A | US13222929A | US13203631A                                          1
JP201176520A | WO2011JP59839A                                                                                   1
JP201168476A                                                                                                    1
                                                                                                               ..
EP2010172993A                                                                                                   1
IN2009CH2439A | IN2009CH2636A | US2009265540P | IN2010CH158A | IN2010CH1514A | IN2010CH1513A | US2010899416A    1
EP200914070A | WO2010EP65180A                                                                                   1
US2009288697P | WO2010EP7805A                                                                                   1
GB200117645A | US2002200023A                                                                                    1
Name: Priority Number, Length: 2784, dtype: int64


Priority Date
2012-04-27                 8
2011-06-29                 8
2011-09-16                 8
2011-12-22                 7
2010-09-29                 7
                          ..
2009-04-25 | 2010-03-31    1
2008-11-13                 1
2008-11-04 | 2009-11-04    1
2008-11-07 | 2009-11-04    1
2001-07-19 | 2002-07-19    1
Name: Priority Date, Length: 2045, dtype: int64


Application Number
US13653717A    1
US13426687A    1
US13970109A    1
US13375329A    1
US13417536A    1
              ..
US13210440A    1
US13722523A    1
US13508881A    1
US13517151A    1
US13690646A    1
Name: Application Number, Length: 2784, dtype: int64


Application Date
2013-03-15    13
2013-01-31    11
2012-04-13    11
2013-02-01    10
2013-03-14    10
              ..
2007-03-06     1
2010-07-13     1
2007-06-29     1
2009-02-18     1
2009-07-06     1
Name: Application Date, Length: 1205, dtype: int64


Publication Kind Code
B2    2554
B1     230
Name: Publication Kind Code, dtype: int64


Publication Date
2014-12-30    2784
Name: Publication Date, dtype: int64


Inventor - w/address
Matsuda Yoshimoto|Kobe, JP                                                                                                                                                                                                                      3
Forsell Peter|Bouveret, CH                                                                                                                                                                                                                      2
Gao Hua|Fox Point, WI, US                                                                                                                                                                                                                       2
Horstman John Bernard|Midland, MI, US | Swier Steven|Midland, MI, US                                                                                                                                                                            2
Moriwaki Hiroyuki|Osaka, JP                                                                                                                                                                                                                     2
                                                                                                                                                                                                                                               ..
Hughes Gregory|Rahway, NJ, US | Devine Paul N.|Rahway, NJ, US | Fleitz Fred J.|Rahway, NJ, US | Grau Brendan T.|Rahway, NJ, US | Limanto John|Rahway, NJ, US | Savile Christopher|Redwood City, CA, US | Mundorff Emily|Poughkeepsie, NY, US    1
Murphy Joseph|Highland Park, IL, US | Hartmann Lucas|Chicago, IL, US | Stone Randall G.|McHenry, IL, US | Jozwik Keith|Lindenhurst, IL, US                                                                                                      1
Broer Dirk Jan|Geldrop, NL | Peeters Emiel|Eindhoven, NL                                                                                                                                                                                        1
Braeckman Karl Ghislain|Gerpinnes, BE | Krols Roel|Antwerp, BE | Bettiol Jean-Luc Philippe|Brussels, BE                                                                                                                                         1
Nagy Zsuzsanna|Birmingham, GB                                                                                                                                                                                                                   1
Name: Inventor - w/address, Length: 2768, dtype: int64


Assignee/Applicant
Canon Kabushiki Kaisha,Tokyo,JP                                                                                                                                                                                                                            8
Sony Corporation,Tokyo,JP                                                                                                                                                                                                                                  6
International Business Machines Corporation,Armonk,NY,US                                                                                                                                                                                                   6
Seagate Technology LLC,Cupertino,CA,US                                                                                                                                                                                                                     5
Samsung Electronics Co. Ltd.,Suwon-si,KR                                                                                                                                                                                                                   4
                                                                                                                                                                                                                                                          ..
Centre National de la Recherche Scientifique,Paris,FR | Bondu François,Servon sur Vilaine,FR | Brunel Marc,Rennes,FR | Alouini Mehdi,Gosne,FR | Vallet Marc,Thorigne-Fouillard,FR | Loas Goulc'hen,Saint Aubin d'Auligne,FR | Romanelli Marco,Rennes,FR    1
Covidien LP,Mansfield,MA,US | Kleyman Gennady,Brooklyn,NY,US | Okoniewski Gregory G.,North Haven,CT,US                                                                                                                                                     1
ZF Friedrichshafen AG,Friedrichshafen,DE | Hunold Bernard,Friedrichshafen,DE | Lubke Eckhardt,Friedrichshafen,DE | Renner Stefan,Bodman-Ludwigshafen,DE                                                                                                    1
Alcon Research Ltd.,Fort Worth,TX,US | Chowhan Masood A.,Arlington,TX,US | Ghosh Malay,Fort Worth,TX,US | Asgharian Bahram,Arlington,TX,US | Han Wesley Wehsin,Arlington,TX,US                                                                             1
Isis Innovation Ltd.,Oxford,GB                                                                                                                                                                                                                             1
Name: Assignee/Applicant, Length: 2704, dtype: int64


Assignee - Current US
SAMSUNG ELECTRONICS CO. LTD.                42
QUALCOMM INCORPORATED                       35
CANON KABUSHIKI KAISHA                      25
MICROSOFT TECHNOLOGY LICENSING LLC          20
LG ELECTRONICS INC.                         20
                                            ..
NXGN MANAGEMENT LLC                          1
VITA-MIX MANAGEMENT CORPORATION              1
ZTE CORPORATION                              1
NISHIKEN DEVISE CO. LTD. | ANZAI SATOSHI     1
LDR MEDICAL                                  1
Name: Assignee - Current US, Length: 1731, dtype: int64


DWPI Class
T01 E                                        150
T01 E |  W01 E                               135
W01 E |  W02 E                                54
W01 E                                         51
B04 C |  D16 C                                37
                                            ... 
U24 E |  X16 E                                 1
L03 C |  U11 E |  U12 E |  X15 E |  X16 E      1
A18 C |  A85 C |  G03 C |  L03 C |  T01 E      1
U11 E |  P42 N |  P62 N                        1
B04 C |  B05 C |  D16 C                        1
Name: DWPI Class, Length: 1484, dtype: int64


DWPI Manual Codes
Not available                                                                                                                                                                                                              242
W01-A06C4                                                                                                                                                                                                                    5
Q35-B                                                                                                                                                                                                                        4
T01-G11A | T01-L01                                                                                                                                                                                                           4
T01-E01A                                                                                                                                                                                                                     4
                                                                                                                                                                                                                          ... 
T06-D07B                                                                                                                                                                                                                     1
T01-D02 | T01-J08A2 | T01-J18 | U22-G03 | W04-N05A1 | W04-V05                                                                                                                                                                1
T01-C03A | T01-E01A | T01-F03 | T01-F05B2 | T01-F05G3 | T01-J05B4P | T01-N02A3C | T01-N02B1E | W01-A06B7G                                                                                                                    1
T01-F02C1 | T01-F03A | T01-F05G3 | T01-S03                                                                                                                                                                                   1
B02-A | B02-C01 | B02-G | B02-R | B02-T | B04-C01G | B04-F01 | B04-J01 | B04-N04 | B05-A01B | B06-H | B07-H | B10-A18 | B10-B01B | B10-C04C | B10-C04E | B11-C08E2 | B12-K04E | B14-G02 | B14-J01A4 | B14-L06 | D05-H09      1
Name: DWPI Manual Codes, Length: 2483, dtype: int64


IPC - Current
G06K000900                                                                                                                                                                                    7
G06F001730                                                                                                                                                                                    5
H04N000718                                                                                                                                                                                    4
G06F001200                                                                                                                                                                                    4
G06F0015173                                                                                                                                                                                   4
                                                                                                                                                                                             ..
A61K0031765 | A61K000900 | A61K000910 | A61K0031165 | A61K004702 | A61K004732 | A61K004736 | A61K000914                                                                                       1
G05B002302 | A61M0005172 | G06F001900                                                                                                                                                         1
G06F001516 | H04L002908 | H04L002912 | H04L002906                                                                                                                                             1
C12P001300 | C12N000910 | C12P001710 | C12P001712 | C12P001718                                                                                                                                1
A61P002528 | A61K003100 | A61K003119 | A61K0031395 | A61K0031436 | A61K0031439 | A61K0031496 | A61K0031517 | A61K003156 | A61K0031573 | A61K0031704 | A61K004506 | G01N003350 | G01N003368    1
Name: IPC - Current, Length: 2729, dtype: int64


CPC - Current
A45F0005021 | A45F000502 | A45F2005026 | A45F22000583                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                2
B08B000300 | A47L00114086 | B08B223001                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               1
H05K00033436 | H01L0021563 | H01L002475 | H01L002481 | H01L002483 | H05K000328 | H05K000334 | H01L0023564 | H01L222416225 | H01L222473104 | H01L222475272 | H01L222475281 | H01L222481191 | H01L222481192 | H01L222481815 | H01L222483191 | H01L222483192 | H01L22248388 | H01L222483951 | H01L22249211 | H01L292401005 | H01L292401006 | H01L292401033 | H01L292401082 | H01L2924014 | H01L2924351 | H05K0003303 | H05K22010129 | H05K220110674 | H05K220110977 | H05K2203167 | Y02P007050 | Y10T01561304                                                                                                                                                                                                                                           1
B01D00539409 | B01D00539431 | B01D00539468 | B01D00539477 | B01J0023464 | B01J002906 | B01J0029061 | B01J0029082 | B01J0029088 | B01J0029126 | B01J0029146 | B01J0029166 | B01J0029405 | B01J002944 | B01J002946 | B01J0029505 | B01J002954 | B01J002956 | B01J00297007 | B01J00297057 | B01J00297215 | B01J00297415 | B01J00297615 | B01J00297815 | B01J0035023 | B01J003504 | B01J003510 | B01J00351076 | B01J00370036 | B01J00370217 | B01J00370246 | F01N0003035 | F01N00032066 | B01D00539418 | B01D00539422 | B01D22552065 | B01D225520738 | B01D225520761 | B01D225550 | B01D22559155 | B01D225592 | B01D22559202 | B01D2258012 | B01D2258014 | B01D227530 | B01D227930 | F01N00030842 | F01N231006 | F01N251006 | Y02T001012 | Y10S005530    1
A61F000501 | A61H0001006 | A61H22011284 | A61H22011623 | A61H22011635 | A61H22011664 | A61H22030431 | A61H2205081                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    1
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ..
C11D000183 | C11D000194 | C11D000129 | C11D000172 | C11D000175 | C11D000190                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          1
A61K0031433 | A61K0031415 | A61K00314155 | A61K0031422 | A61K0031427 | A61K00314439 | A61K0031444 | A61K0031455 | A61K0031496 | A61K0031506 | A61K00315377 | A61K004506 | A61P002900 | C07D0207327 | C07D0207337 | C07D023112 | C07D0295195 | C07D040104 | C07D040110 | C07D040112 | C07D040114 | C07D040304 | C07D040310 | C07D040312 | C07D040314 | C07D041310 | C07D041312 | C07D041314 | C07D041710 | C07D041712 | C07D041714 | C12N00050634 | C12N250046 | Y02A005030                                                                                                                                                                                                                                                                           1
A23L0033135 | A23L000252 | A61K000899 | A61K003574 | A61P000102 | A61Q001100 | C12N000120 | Y10S0435853 | Y10S0435854 | Y10S0435885                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  1
C08F023614 | B60C000100 | C08C001944 | C08F000448 | C08F003604 | C08F013614 | C08L000900 | C08L000906 | C08L220502 | C08L231400 | Y10T0428139                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        1
A61K003119 | A61K0031395 | A61K0031439 | A61K0031496 | A61K0031517 | A61K003156 | A61K0031573 | A61K0031704 | A61K004506 | A61P002528 | G01N00335005 | G01N00335008 | G01N00335044 | G01N00336896 | G01N250000 | G01N250010                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          1
Name: CPC - Current, Length: 2783, dtype: int64


US Class
370329                                                                                 7
382128                                                                                 7
370328                                                                                 5
370392                                                                                 3
525477                                                                                 3
                                                                                      ..
429430 | 429431 | 429535                                                               1
435128 | 435121 | 435122 | 435193                                                      1
439320 | 439461 | 439585                                                               1
250436 | 2107481 | 250435 | 252180                                                     1
5140178 | 435004 | 43500724 | 435029 | 435366 | 514034 | 514183 | 51425217 | 514557    1
Name: US Class, Length: 2697, dtype: int64


Abstract
A steam appliance includes a steam applicator which is connectable to the steam appliance, but the steam applicator is permitted to rotate without loosening or disengaging the connection of the steam applicator to the steam appliance. Embodiments may be particularly suitable for use with a portable, handheld steam appliance that employs steam pocket technology.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     1
Solder bumps are formed on a plurality of electrode parts of a printed substrate and a semiconductor chip is loaded on the printed substrate via the plurality of solder bumps. In this case, a thermoplastic film is prepared as an underfill that covers a surface of the printed substrate on which the solder bumps are formed. In the film, parts corresponding to the solder bumps are removed and a peripheral edge of a part on which the semiconductor chip will be loaded has a protruded form. After the printed substrate has been covered with the film, the film is bonded onto the board and the semiconductor chip is loaded on the printed substrate and carried into a reflow furnace. In the reflow furnace, heat and pressure are applied to fuse the solder bumps.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         1
A filter for filtering particulate matter (PM) from exhaust gas emitted from a positive ignition engine or a compression ignition engine, which filter comprising a porous substrate having inlet surfaces and outlet surfaces, wherein the inlet surfaces are separated from the outlet surfaces by a porous structure containing pores of a first mean pore size, wherein the porous substrate is coated with a washcoat comprising a plurality of solid particles wherein the porous structure of the washcoated porous substrate contains pores of a second mean pore size, and wherein the second mean pore size is less than the first mean pore size.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    1
The invention provides a lumbago treatment instrument which manipulates the pelvis safely and properly by pressing the coccyx utilizing the patient's own body weight. A coccyx contact treatment member is disposed inside a cylindrical casing so as to be movable in the vertical direction via an elastic member. A coccyx contact buffering member made of sponge or the like is provided on the upper end of the coccyx contact treatment member. The patient straddles the coccyx contacting buffering member, assuming a sitting posture, and places the coccyx on the coccyx contact buffering member. In this posture, both feet are slightly lifted from the floor to apply the body weight on the coccyx contact buffering member so that the coccyx is pushed up from below. When doing so, the patient continues to maintain an upright posture while pressing the upper body against a posture holding member and gripping a handle with both hands.  | \n\nL'invention a pour but de manipuler le bassin d'une manière sûre et correcte par compression du coccyx par utilisation du propre poids corporel du patient. A cet effet, selon l'invention, une partie thérapeutique (9a) de contact avec le coccyx est disposée à l'intérieur d'un boîtier cylindrique (7) de façon à pouvoir se déplacer dans la direction verticale par l'intermédiaire d'un corps élastique (10). L'extrémité supérieure de celle-ci comporte un coussin (11) de contact avec le coccyx, configuré à partir d'une éponge, etc. Le patient chevauche le coussin (11) de contact avec le coccyx, adoptant une posture comme s'il était assis sur celui-ci, et place le coccyx sur le coussin (11) de contact avec le coccyx. Dans ladite posture, les deux pieds sont légèrement soulevés du sol pour appliquer le poids corporel sur le coussin (11) de contact avec le coccyx et comprimer le coccyx vers le haut à partir du dessous. En effectuant ceci, le patient continue à maintenir une posture verticale par compression de la moitié supérieure du corps contre une structure (2) de maintien de posture et saisie des poignées avec les deux mains.    1
A fail detecting device for a rotation angle sensor, for detecting a fail of the rotation angle sensor even if the number of rotation angle sensors is one. A cam is configured to be driven to rotate in one direction by an electric motor to reciprocate a push rod. An output voltage of an angle sensor is set so that the region equal to or lower than a first predetermined voltage and the region equal to or higher than a second predetermined voltage higher than the first predetermined voltage are recognized as a dead zone. The elapsed time after the transition to the dead zone is measured by a timer and it is determined that the angle sensor is in the fail state if the output voltage corresponding to the dead zone is detected although the estimated time of the passage through the dead zone has elapsed.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       1
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ..
The need for a liquid hand dishwashing detergent composition, having excellent low temperature stability and delivering good cleaning and long-lasting suds, is met by incorporating a branched, alkoxylated nonionic surfactant, in combination with ethoxylated anionic surfactants having little or no branching, into the composition. Surprisingly, such a combination also provides an excellent sudsing profile during direct application dishwashing methods.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           1
Disclosed are novel calcium release-activated calcium (CRAC) channel inhibitors, methods for preparing them, pharmaceutical compositions containing them, and methods of treatment using them. The present disclosure also relates to methods for treating non-small cell lung cancer (NSCLC) with CRAC inhibitors, and to methods for identifying therapeutics for treating and of diagnosing cancer.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          1
The invention relates to the area of health-beneficial preparations and production methods thereof, in particular to the use of thermally pre-treated Lactobacillus preparations having specific bonding capacity for Streptococcus mutans for caries prophylaxis. The invention further relates to the Lactobacillus preparations and thermal pasteurization.  | \n\nDie Erfindung betrifft das Gebiet gesundheitsförderlicher Zubereitungen und ihrer Herstellverfahren, insbesondere die Verwendung von thermisch vorbehandelten Lactobacillus-Zubereitungen mit spezifischer Bindungsfähigkeit für Streptococcus mutans zur Kariesprophylaxe. Unabhängige Ansprüche sind gerichtet auf die Lactobacillus-Zubereitungen sowie auf die thermische Pasteurisierung.  | \n\nL'invention concerne le domaine des préparations favorables à la santé et de leurs procédés de fabrication, en particulier l'utilisation de préparations de Lactobacillus prétraitées thermiquement avec une capacité de liaison spécifique pour Streptococcus mutans, pour la prophylaxie des caries. Les revendications indépendantes se rapportent aux préparations de Lactobacillus ainsi qu'à la pasteurisation thermique.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     1
The invention provides a first composition comprising at least the following: i) a modified polymer comprising at least one branched modified polymer macromolecule (b1) and at least one linear modified polymer macromolecule (a1), and wherein the at least one branched modified polymer macromolecule and the at least one linear modified polymer macromolecule each, independently, comprises at least one amine group selected from the group consisting of formulas (1A-1F), each as described above: and combinations thereof; and wherein the at least one branched modified polymer macromolecule further comprises one of the structures (ib1-ib4) as described above, and the at least one linear modified polymer macromolecule further comprises one of the structures (iib1) as described above (see Formula 3A).  | \n\nL'invention concerne une première composition comprenant au moins le composant suivant : i) un polymère modifié comprenant au moins une macromolécule de polymère modifié ramifié (b1) et au moins une macromolécule de polymère modifié linéaire (a1), dans lequel la ou les macromolécules de polymère modifié ramifié et la ou les macromolécules de polymère modifié linéaire comprennent chacune, indépendamment, au moins un groupe amine choisi dans l'ensemble constitué des formules (1A-1F), chacune étant telle que décrite ci-dessus ; et leurs combinaisons ; et dans lequel la ou les macromolécules de polymère modifié ramifié comprennent en outre une des structures (ib1-ib4) comme il est décrit ci-dessus, et la ou les macromolécules de polymère modifié linéaire comprennent en outre une des structures (iib1) comme il est décrit ci-dessus (voir formule 3A)                                                                                                                                                                                                                                                                                                                                                                                                                               1
The invention relates to therapeutic agents for use in the prevention or treatment of Alzheimer's disease. In particular the invention relates to use of inhibitors of cell cycle reentry and progression to the G1/S transition or inhibitors of progression of the cell cycle through the G1/S transition point in the prevention or treatment of Alzheimer's disease.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        1
Name: Abstract, Length: 2784, dtype: int64


Title (Original language)
Semiconductor device                                                          7
Light emitting device                                                         4
Display device                                                                3
User interface system                                                         3
Liquid crystal display device                                                 3
                                                                             ..
Photo-responsive layer and layer assembly                                     1
Stable sustainable hand dish-washing detergents                               1
Modulators of calcium release-activated calcium channel                       1
Health-beneficial preparation and production method                           1
Therapeutic strategies for prevention and treatment of alzheimer's disease    1
Name: Title (Original language), Length: 2756, dtype: int64


Claims
The invention claimed is: \n1. A steam cleaning appliance, comprising: \na steam generation unit; \na steam cleaning applicator; and \na flexible steam conduit configured to guide steam from the steam generation unit to a steam inlet for the steam cleaning applicator; \nwherein the steam cleaning applicator is connectable to the steam conduit; \nthe steam cleaning applicator is rotatable relative to the steam conduit in either rotational direction without loosening the connection of the steam applicator to the steam conduit; \nthe steam cleaning applicator has an end-to-end direction and \nthe steam cleaning applicator is rotatable by at least 360 degrees relative to the steam conduit in either rotational direction about the end-to-end direction of the steam cleaning applicator, without loosening the connection of the steam cleaning applicator to the steam conduit. \n2. A steam cleaning appliance as in claim 1, wherein the steam applicator is connectable to the steam conduit via a handle.\n3. A steam cleaning appliance as in claim 2, wherein the handle has an end-to-end direction, and the handle is rotatable relative to the steam conduit about the end-to-end direction of the handle in either rotational direction without loosening the connection of the steam cleaning applicator to the steam conduit.\n4. A steam cleaning appliance as in claim 1, wherein the steam cleaning applicator is repeatedly rotatable relative to the steam conduit in either rotational direction about an end-to-end direction of the steam cleaning applicator without loosening the connection of the steam cleaning applicator to the steam conduit.\n5. A steam cleaning appliance as in claim 1, wherein the steam cleaning applicator is connectable to the steam conduit with a tool-free connection.\n6. A steam cleaning appliance as in claim 5, wherein at least two distinct user actions are required to remove the steam cleaning applicator from the steam conduit.\n7. A steam cleaning appliance as in claim 6, wherein the at least two distinct user actions comprise applying an end-to-end force on a handle relative to the steam conduit, and applying a twisting force on the handle relative to the steam conduit.\n8. A steam cleaning appliance as in claim 5, further comprising a connector that is constructed and arranged to permit rotation of the steam cleaning applicator relative to the steam conduit about an end-to-end direction of the steam applicator in either rotational direction without loosening the connection of the steam cleaning applicator to the steam conduit.\n9. A steam cleaning appliance as in claim 8, wherein the connector comprises a threaded connector having: (a) an external thread portion positioned on either the steam cleaning applicator or the steam conduit, and (b) an internal thread portion positioned on the other of the steam applicator and the steam conduit.\n10. A steam cleaning appliance as in claim 9, wherein: \nthe external thread portion is selectively rotatable relative to whichever of the steam cleaning applicator and the steam conduit that the external thread portion is positioned on, and/or the internal thread portion is selectively rotatable relative to whichever of the steam cleaning applicator and the steam conduit that the internal thread portion is positioned on. \n11. A steam cleaning appliance as in claim 10, wherein when a user applies at least a threshold force in an end-to-end direction of a handle of the steam applicator, the selectively rotatable thread portion(s) is prevented from rotating more than 180 degrees in either rotational direction relative to whichever of the steam applicator and the steam conduit that the selectively rotatable thread portion(s) is positioned on, as long as the user continues to apply the at least a threshold force.\n12. A steam cleaning appliance as in claim 11, wherein when the at least a threshold force is applied, the at least a threshold force overcomes a force provided by a resilient element.\n13. A steam cleaning appliance as in claim 12, wherein the at least a threshold force is transferred to the thread portions of the connector.\n14. A steam cleaning appliance as in claim 13, wherein the resilient element comprises a coil spring, and the at least a threshold force compresses the spring such that engagement elements on the selectively rotatable thread portion(s) engage with complementary engagement elements fixed to whichever of the steam cleaning applicator and the steam conduit that the selectively rotatable thread portion(s) is positioned on.\n15. A steam cleaning appliance as in claim 14, wherein the internal thread portion is selectively rotatable relative to whichever of the steam cleaning applicator and the steam conduit that the internal thread portion is positioned on.\n16. A steam cleaning appliance as in claim 15, wherein the internal thread portion is positioned on the handle of the steam cleaning applicator.\n17. A steam cleaning appliance as in claim 1, wherein the steam conduit comprises a flexible hose.\n18. A steam cleaning appliance as in claim 1, wherein the steam cleaning applicator includes a handle that is connected to the steam conduit.\n19. A steam cleaning appliance as in claim 2, wherein the handle is detachably connectable to the steam applicator.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       1
What is claimed is: \n1. A printed substrate manufacturing method of forming solder bumps on a plurality of electrode parts of a printed substrate and mounting a semiconductor chip on the printed substrate via the plurality of solder bumps, comprising: \npreparing a thermoplastic film to be used as an underfill that covers a surface of the printed substrate on which the solder bumps are formed, wherein parts of the film corresponding to the solder bumps are removed and a peripheral edge of a part of the film on which the semiconductor chip will be mounted has a protruded form for preventing movement of the semiconductor chip on the printed substrate; \ncovering the printed substrate with the film and thereafter bonding the film onto the printed substrate, wherein the parts of the film corresponding to the solder bumps are removed before covering the printed substrate with the film; \nmounting the semiconductor chip on the printed substrate and carrying the printed substrate into a reflow furnace; and \nbonding by applying heat and pressure to fuse the solder bumps in the reflow furnace. \n2. A method of manufacturing a printed substrate comprising steps of: \npreparing an underfill film by forming a plurality of holes through the film and forming at least one protruded form on a peripheral edge of the film, wherein the at least one protruded form is disposed on a first surface of the film, and the at least one protruded form extends away from the first surface of the film; \nafter preparing the film, covering a printed substrate with the film by aligning a plurality of solder bumps on the printed substrate with the plurality of holes through the film and thereafter bonding the film onto the printed substrate; \nplacing a semiconductor chip on the printed substrate via the plurality of solder bumps and carrying the printed substrate into a reflow furnace; and \napplying heat and pressure in the reflow furnace to adhere the semiconductor chip to the printed substrate. \n3. The method of manufacturing a printed substrate according to claim 2, wherein the step of preparing the film further comprises drawing the film from a film roll, cutting the film to a predetermined size, and drilling the plurality of holes through the film.\n4. The printed substrate manufacturing method according to claim 2, wherein a second surface of the film faces the printed substrate after covering the printed substrate with the film, and the second surface of the film forms one side of the film and the first surface of the film forms an opposite side of the film.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            1
The invention claimed is: \n1. A system for filtering particulate matter from exhaust gas, said system comprising: \na porous structure having substrate pores of a first mean pore size; a selective catalytic reduction (SCR) washcoat disposed on a surface of the porous structure or within the porous structure to define pores of a second mean pore size; and the second mean pore size is less than the first mean pore size; \nwherein said washcoat comprises a small pore zeolite promoted with at least one metal selected from the group consisting of Cr, Co, Cu, Fe, Hf, La, Ce, In, V, Mn, Ni, Zn, Ga, Ag, Au, Pt, Pd, and Rh; \na NO xabsorber catalyst disposed upstream of the washcoat.\n2. A system according to claim 1, wherein the washcoat is disposed within the porous structure.\n3. A system according to claim 1, wherein the transition metal is selected from the group consisting of Cu, Fe, and Ce.\n4. A system according to claim 1, wherein the zeolite has a CHA framework structure.\n5. A system according to claim 4, wherein the transition metal consists of Cu.\n6. A system according to claim 1, the porous structure is a ceramic wallflow filter.\n7. A system according to claim 1, wherein: the porous structure has substrate pores; and the SCR washcoat is one or more layers substantially covering the substrate pores at the inlet surfaces.\n8. A system according to claim 1, wherein: the washcoat is present on the inlet surfaces; and the NOxabsorber catalyst is disposed upstream of the porous structure.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      1
The invention claimed is: \n1. A low back pain treatment tool comprising: \na cylindrical casing elongated in a longitudinal direction; \na coccyx contact treatment member which is placed through an elastic member so as to be slidably movable in an axial direction of the cylindrical casing; \na coccyx contact buffering member which is provided on an upper end of the coccyx contact treatment member; \na posture holding member which has a posture holding surface in a longitudinal direction, which faces the cylindrical casing; and \na handle fixed to which the posture holding member. \n2. The low back pain treatment tool according to claim 1, wherein the cylindrical casing is fixed and supported on the posture holding member by fixing a horizontal seat plate vertically with respect to the posture holding surface and coupling a lower end of the cylindrical casing to an upper surface of the horizontal seat plate.\n3. The low back pain treatment tool according to claim 1, wherein the cylindrical casing is fixed and supported on the posture holding member by fixing the posture holding member on a horizontal base plate, fixing a pair of left and right side plates orthogonally to a horizontal surface of the base plate and the posture holding surface, and attaching a horizontal seat plate between the side plates.\n4. A low back pain treatment tool comprising: \na cylindrical casing elongated in a longitudinal direction; \na coccyx contact treatment member which is slidably placed through an elastic member in an axial direction of the cylindrical casing; \na coccyx contact buffering member which is provided on an upper end of the coccyx contact treatment member; \na posture holding member having a posture holding surface in a longitudinal direction, which faces the cylindrical casing; \na handle fixed to the posture holding member; \na horizontal seat plate which fixes and supports the cylindrical casing on the posture holding member by being fixed vertically with respect to the posture holding surface and coupling a lower end of the cylindrical casing to an upper surface of the horizontal seat plate; \na horizontal base plate which fixes the posture holding member; \na pair of left and right side plates which are fixed orthogonally to a horizontal surface of the base plate and the posture holding surface, and which support left and right sides of the horizontal base plate respectively; \ncorner portions formed by an outer surface of either of the side plates, the posture holding surface, and a horizontal surface of the base plate; and \nrectangular parallelepiped foot rest blocks which are detachably placed at the corner portions.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     1
What is claimed is: \n1. A fail detecting device for a rotation angle sensor, comprising: \na cam with a continuously formed cam surface having an actuating surface for reciprocating a push rod and a non-actuating surface that does not reciprocate the push rod, \nan angle sensor formed of an endless rotary potentiometer for detecting a rotation angle of the cam and having an output voltage increasing in proportion to the rotational angle in a range of 360 degrees, and \na controller for detecting a fail state of the angle sensor, \nsaid cam is configured to be driven to rotate in one direction by an electric motor controlled by the controller and to reciprocate the push rod; \nthe output voltage of the angle sensor detects:  \na first region equal to or lower than a first predetermined voltage from 0 degrees to an angle ? 1, and\na second region equal to or higher than a second predetermined voltage higher than the first predetermined voltage from 360 degrees to an angle ? 2,\nsaid first and second regions being recognized as a dead zone; \nthe controller is configured to drive the rotation of the cam to a predetermined position in the non-actuating surface at a constant speed in transition of the cam surface of the cam abutting against the push rod from a side of the actuating surface to a side of the non-actuating surface; and \nthe angle sensor is configured wherein the dead zone is disposed at a position in the non-actuating surface of the cam and in an area in front of the predetermined position. \n2. The fail detecting device for a rotation angle sensor according to claim 1, wherein the controller measures an elapsed time from transition of the cam surface to the dead zone by a timer and determines that the rotation angle sensor is in a fail state if the dead zone is detected although an estimated time of passage through the dead zone has elapsed.\n3. The fail detecting device for a rotation angle sensor according to claim 2, wherein the controller stores the output voltage of timing to transition to the dead zone as a saved value and determines that the rotation angle sensor is in the fail state if the output voltage is the same as the saved value although an estimated time of passage through the dead zone has elapsed and a predetermined time has elapsed in this state.\n4. The fail detecting device for a rotation angle sensor according to claim 2, wherein the controller determines that the rotation angle sensor is in the fail state if the output voltage is outside a range between upper and lower limits set in advance although an estimated time of passage through the dead zone has elapsed and a predetermined time has elapsed in this state.\n5. The fail detecting device for a rotation angle sensor according to claim 2, wherein the controller stores a sensor value of timing to transition to the dead zone as a saved value and determines that the rotation angle sensor is in the fail state if the output voltage is not a value corresponding to the predetermined position in the non-actuating surface although an estimated time of passage through the dead zone has elapsed.\n6. The fail detecting device for a rotation angle sensor according to claim 1, wherein the controller measures an elapsed time from transition of the cam surface from the actuating surface to the non-actuating surface by a timer and determines that the rotation angle sensor is in a fail state if the dead zone is detected although an estimated time of passage through the dead zone has elapsed.\n7. The fail detecting device for a rotation angle sensor according to claim 6, wherein the controller stores the output voltage of timing to transition to the dead zone as a saved value and determines that the rotation angle sensor is in the fail state if the output voltage is the same as the saved value although an estimated time of passage through the dead zone has elapsed and a predetermined time has elapsed in this state.\n8. The fail detecting device for a rotation angle sensor according to claim 6, wherein the controller determines that the rotation angle sensor is in the fail state if the output voltage is outside a range between upper and lower limits set in advance although an estimated time of passage through the dead zone has elapsed and a predetermined time has elapsed in this state.\n9. The fail detecting device for a rotation angle sensor according to claim 6, wherein the controller stores a sensor value of timing to transition to the dead zone as a saved value and determines that the rotation angle sensor is in the fail state if the output voltage is not a value corresponding to the predetermined position in the non-actuating surface although an estimated time of passage through the dead zone has elapsed.\n10. The fail detecting device for a rotation angle sensor according to claim 1, wherein the dead zone is positioned corresponding to 0 degrees as the angle of rotation with a range of ?1 to-?2 defining the dead zone and with the area ?1 to 90 degrees defining a standby area and with the area ?2 to 270 degrees defining a bridge area.\n11. A fail detecting device for a rotation angle sensor comprising: \na cam having a continuously formed cam surface with an actuating surface for imparting motion to reciprocates a push rod and a non-actuating surface that does not impart motion to reciprocate the push rod; \nan angle sensor formed of an endless rotary potentiometer for detecting an angle of rotation of the cam and having an output voltage increasing in proportion to the rotational angle in a range of 360 degrees; \na controller for detecting a fail state of the angle sensor; \nsaid cam being configured to be driven to rotate in one direction by a motor controlled by the controller to reciprocate the push rod; and \nthe output voltage of the angle sensor detects:  \na first region equal to or lower than a first predetermined voltage from 0 degrees to an angle ? 1, and\na second region equal to or higher than a second predetermined voltage higher than the first predetermined voltage from 360 degrees to an angle ? 2,\nsaid dead zone is defined by the first and second regions; \nsaid controller being configured to drive the rotation of the cam to a predetermined position relative to the non-actuating surface at a constant speed in transition of the cam surface of the cam abutting against the push rod from a side of the actuating surface to a side of the non-actuating surface; \nsaid angle sensor being configured wherein the dead zone is disposed at a position in the non-actuating surface of the cam and in an area in front of the predetermined position. \n12. The fail detecting device for a rotation angle sensor according to claim 11, wherein the controller measures an elapsed time from transition of the cam surface to the dead zone by a timer and determines that the rotation angle sensor is in a fail state if the dead zone is detected although an estimated time of passage through the dead zone has elapsed.\n13. The fail detecting device for a rotation angle sensor according to claim 12, wherein the controller stores the output voltage of timing to transition to the dead zone as a saved value and determines that the rotation angle sensor is in the fail state if the output voltage is the same as the saved value although an estimated time of passage through the dead zone has elapsed and a predetermined time has elapsed in this state.\n14. The fail detecting device for a rotation angle sensor according to claim 12, wherein the controller determines that the rotation angle sensor is in the fail state if the output voltage is outside a range between upper and lower limits set in advance although an estimated time of passage through the dead zone has elapsed and a predetermined time has elapsed in this state.\n15. The fail detecting device for a rotation angle sensor according to claim 12, wherein the controller stores a sensor value of timing to transition to the dead zone as a saved value and determines that the rotation angle sensor is in the fail state if the output voltage is not a value corresponding to the predetermined position in the non-actuating surface although an estimated time of passage through the dead zone has elapsed.\n16. The fail detecting device for a rotation angle sensor according to claim 11, wherein the controller measures an elapsed time from transition of the cam surface from the actuating surface to the non-actuating surface by a timer and determines that the rotation angle sensor is in a fail state if the dead zone is detected although an estimated time of passage through the dead zone has elapsed.\n17. The fail detecting device for a rotation angle sensor according to claim 16, wherein the controller stores the output voltage of timing to transition to the dead zone as a saved value and determines that the rotation angle sensor is in the fail state if the output voltage is the same as the saved value although an estimated time of passage through the dead zone has elapsed and a predetermined time has elapsed in this state.\n18. The fail detecting device for a rotation angle sensor according to claim 16, wherein the controller determines that the rotation angle sensor is in the fail state if the output voltage is outside a range between upper and lower limits set in advance although an estimated time of passage through the dead zone has elapsed and a predetermined time has elapsed in this state.\n19. The fail detecting device for a rotation angle sensor according to claim 16, wherein the controller stores a sensor value of timing to transition to the dead zone as a saved value and determines that the rotation angle sensor is in the fail state if the output voltage is not a value corresponding to the predetermined position in the non-actuating surface although an estimated time of passage through the dead zone has elapsed.\n20. The fail detecting device for a rotation angle sensor according to claim 11, wherein the dead zone is positioned corresponding to 0 degrees as the angle of rotation with a range of ?1 to-?2 defining the dead zone and with the area ?1 to 90 degrees defining a standby area and with the area ?2 to 270 degrees defining a bridge area.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      1
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ..
What is claimed is: \n1. A liquid hand dishwashing detergent composition comprising: \na. from about 2% to about 70% by weight of the composition of an ethoxylated anionic surfactant derived from a fatty alcohol, wherein:  \ni. at least about 90% by weight of said fatty alcohol is linear, and \nii. said fatty alcohol has an average degree of ethoxylation of from about 1 to about 2; and \nb. from about 0.1 to about 5% by weight of the composition of an ethoxylated branched nonionic surfactant, having an average degree of ethoxylation of about 8; \n wherein the total amount of surfactant is from about 10 to about 85% by weight of the liquid detergent composition, wherein said ethoxylated anionic surfactant is a saturated C 10-C14 alkyl ethoxysulphate and said ethoxylated branched nonionic surfactant is 3-propyl heptanol, wherein the degree of ethoxylation of said branched nonionic is greater than the degree of ethoxylation of said ethoxylated anionic surfactant.\n2. The composition according to claim 1, wherein said ethoxylated anionic surfactant is present at a level of from about 5% to about 30% by weight of the composition.\n3. The composition according to claim 1, further comprising from about 0.01% to about 20% by weight of amphoteric/zwitterionic surfactants.\n4. The composition according to claim 1, wherein said ethoxylated anionic surfactant is derived from a naturally sourced alcohol.\n5. The composition according to claim 1, wherein said nonionic surfactant is present at a level of from about 0.2% to about 3% by weight of the composition.\n6. The composition according to claim 1, wherein said composition comprises less than about 2% by weight of non-alkoxylated branched alcohol.\n7. The method for hand washing dishes, using a composition according to claim 1, wherein the method comprises the step of contacting said composition in undiluted form, with the dish.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     1
We claim: \n1. A compound of formula\n\n or a tautomer, prodrug, N-oxide, pharmaceutically acceptable ester or pharmaceutically acceptable salt thereof, wherein  \nRing Hy represents \n\n optionally substituted with R??;  \nR 1 and R2 are the same or different and are independently selected from CH3, CH2F, CHF2, CF3, substituted or unsubstituted C(3-5)cycloalkyl, CH2—ORa, CH2—NRaRb, CN and COOH with the proviso that;\na) both R 1 and R2 at the same time do not represent CF3,\nb) both R 1 and R2 at the same time do not represent CH3,\nc) when R 1 is CF3 then R2 is not CH3 and\nd) when R 1 is CH3 then R2 is not CF3;\nRing Ar represents: \n\nL 1 and L2 together represent —NH—C(?O)—;\nA is absent; \nR? and R? are the same or different and are independently selected from hydrogen, hydroxy, cyano, halogen, —OR a, —COORa, —S(?O)q—Ra, —NRaRb, —C(?X)—Ra, substituted or unsubstituted C(1-6) alkyl group, substituted or unsubstituted C(1-6) alkenyl, substituted or unsubstituted C(1-6) alkynyl, and substituted or unsubstituted C(3-5) cycloalkyl, or R? and R? may be joined to form a substituted or unsubstituted saturated or unsaturated 3-6 member ring, which may optionally include one or more heteroatoms which may be same or different and are selected from O, NRa and S;\nR?? is selected from hydrogen, hydroxy, cyano, halogen, —OR a, —COORa, —S(?O)q—Ra, —NRaRb, —C(?X)—Ra, substituted or unsubstituted C(1-6) alkyl group, substituted or unsubstituted C(1-6) alkenyl, substituted or unsubstituted C(1-6) alkynyl, and substituted or unsubstituted C(3-5)cycloalkyl\neach occurrence of X is independently selected from O, S and —NR a;\nCy is selected from monocyclic substituted or unsubstituted cycloalkyl group, and monocyclic substituted or unsubstituted aryl; \neach occurrence of R a and Rb are the same or different and are independently selected from hydrogen, nitro, hydroxy, cyano, halogen, —ORc, —S(?O)q—Rc, —NRcRd, —C(?Y)—Rc, —CRcRd—C(?Y)—Rc, —CRcRd—Y—CRcRd—, —C(?Y)—NRcRd—, —NRRd—C(?Y)—NRcRd—, —S(?O)q—NRcRd—, —NRcRd—S(?O)q—NRcRd—, —NRcRd—NRcRd—, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted cycloalkylakyl, substituted or unsubstituted cycloalkenyl, substituted or unsubstituted heterocylyl, substituted or unsubstituted heterocyclylalkyl, substituted or unsubstituted aryl, substituted or unsubstituted arylalkyl, substituted or unsubstituted heteroaryl, and substituted or unsubstituted heteroarylalkyl, or when Ra and Rb are directly bound to the same atom, they may be joined to form a substituted or unsubstituted saturated or unsaturated 3-10 member ring, which may optionally include one or more heteroatoms which may be the same or different and are selected from O, NRc and S;\neach occurrence of R c and Rd may be same or different and are independently selected from hydrogen, nitro, hydroxy, cyano, halogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted cycloalkylakyl, substituted or unsubstituted cycloalkenyl, substituted or unsubstituted heterocyclic group, substituted or unsubstituted heterocyclylalkyl, or when two Rc and/or Rd substitutents are directly bound to the same atom, they may be joined to form a substituted or unsubstituted saturated or unsaturated 3-10 member ring, which may optionally include one or more heteroatoms which are the same or different and are selected from O, NH and S;\neach occurrence of Y is selected from O, S and —NR a; and\neach occurrence of q independently represents 0, 1 or 2. \n2. A compound of claim 1, wherein Hy is selected from\n\n3. A compound of  claim 1, wherein Hy is\n\n4. A compound of  claim 1, wherein Ar is selected from\n\n5. A compound of  claim 1, wherein Cy is\n\n6. A compound of  claim 5, wherein Cy is selected from\n\n7. A compound of  claim 1, wherein the compound has the formula (IA)\n\n or a tautomer, prodrug, N-oxide, pharmaceutically acceptable ester, or pharmaceutically acceptable salt thereof, wherein  \nR 1 and R2 are the same or different and are independently selected from CH3, CH2F, CHF2, CF3, substituted or unsubstituted C(3-5) cycloalkyl, CH2—ORa, CH2—NRaRb, CN and COOH with the proviso that;\na) both R 1 and R2 at the same time do not represent CF3,\nb) both R 1 and R2 at the same time do not represent CH3,\nc) when R 1 is CF3 then R2 is not CH3 and\nd) when R 1 is CH3 then R2 is not CF3;\nU, V and W are the same or different and are independently selected from CR a;\nT is N; \nL 1 and L2 together represent —NH—C(?O)—;\nA is absent; \neach occurrence of R? and R? are the same or different and are independently selected from hydrogen, hydroxy, cyano, halogen, —OR a, —COORa, —S(?O)q—Ra, —NRaRb, —C(?X)—Ra, substituted or unsubstituted C(1-6) alkyl group, substituted or unsubstituted C(1-6) alkenyl, substituted or unsubstituted C(1-6) alkynyl, and substituted or unsubstituted C(3-5) cycloalkyl, or R? and R? may be joined to form a substituted or unsubstituted saturated or unsaturated 3-6 membered ring, which may optionally include one or more heteroatoms which may be same or different and are selected from O, NRa and S;\nR?? is selected from hydrogen, hydroxy, cyano, halogen, —OR a, —COORa, —S(?O)q—Ra, —NRaRb, —C(?X)—Ra, substituted or unsubstituted C(1-6) alkyl group, substituted or unsubstituted C(1-6) alkenyl, substituted or unsubstituted C(1-6) alkynyl, and substituted or unsubstituted C(3-5)cycloalkyl;\neach occurrence of X is independently selected from O, S and —NR a;\nCy is selected from monocyclic substituted or unsubstituted cycloalkyl group, and monocyclic substituted or unsubstituted aryl; \neach occurrence of R a and Rb are the same or different and are independently selected from hydrogen, nitro, hydroxy, cyano, halogen, —ORc, —S(?O)q—Rc, —NRcRd, —C(?Y)—Rc, —CRcRd—C(?Y)—Rc, —CRcRd—Y—CRcRd—, —C(?Y)—NRcRd—, —NRRd—C(?Y)—NRcRd—, —S(?O)q—NRcRd—, —NRcRd—S(?O)q—NRcRd—, —NRcRd—NRcRd—, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted cycloalkylakyl, substituted or unsubstituted cycloalkenyl, substituted or unsubstituted heterocylyl, substituted or unsubstituted heterocyclylalkyl, substituted or unsubstituted aryl, substituted or unsubstituted arylalkyl, substituted or unsubstituted heteroaryl, and substituted or unsubstituted heteroarylalkyl, or when Ra and Rb substitutent are directly bound to the same atom, they may be joined to form a substituted or unsubstituted saturated or unsaturated 3-10 member ring, which may optionally include one or more heteroatoms which may be same or different and are selected from O, NRc and S;\neach occurrence of R c and Rd may be same or different and are independently selected from hydrogen, nitro, hydroxy, cyano, halogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted cycloalkylakyl, substituted or unsubstituted cycloalkenyl, substituted or unsubstituted heterocyclic group, substituted or unsubstituted heterocyclylalkyl, or when two Rc and/or Rd substitutents are directly bound to the same atom, they may be joined to form a substituted or unsubstituted saturated or unsaturated 3-10 member ring, which may optionally include one or more heteroatoms which are the same or different and are selected from O, NH and S;\neach occurrence of Y is selected from O, S and —NR a; and\neach occurrence of q independently represents 0, 1 or 2. \n8. A compound of claim 7, wherein both R1 and R2 represent cyclopropyl.\n9. A compound of claim 7, wherein one of R1 and R2 is CF3 and the other is independently cyclopropyl, CH2F or CHF2.\n10. A compound of claim 7, wherein Cy is selected from\n\n11. A compound of  claim 1, wherein the compound has the formula (IA-III)\n\n or a tautomer, prodrug, N-oxide, pharmaceutically acceptable ester, or pharmaceutically acceptable salt thereof, wherein  \nR 1 and R2 are the same or different and are independently selected from CH2F, CHF2, CF3, cyclopropyl with the proviso that both R1 and R2 at the same time do not represent CF3;\nT is N; \neach of U, V and W is, independently CR a;\nL 1 and L2 together represent —NH—C(?O)—;\nA is absent; \neach occurrence of R? and R? are the same or different and are independently selected from hydrogen or substituted or unsubstituted C (1-6) alkyl group or R? and R? may be joined to form a substituted or unsubstituted saturated or unsaturated 3-6 membered ring, which may optionally include one or more heteroatoms which may be same or different and are selected from O, NRa and S;\nR?? is selected from hydrogen or halogen; \neach occurrence of X is independently selected from O, S and —NR a;\nCy is substituted or unsubstituted aryl; \neach occurrence of R a and Rb are the same or different and are independently selected from hydrogen, nitro, hydroxy, cyano, halogen, —ORc, —S(?O)q—Rc, —NRcRd, —C(?Y)—Rc, —CRcRd—C(?Y)—Rc, —CRcRd—Y—CRcRd—, —C(?Y)—NRcRd—, —NRRd—C(?Y)—NRcRd—, —S(?O)q—NRcRd—, —NRcRd—S(?O)q—NRcRd—, —NRcRd—NRcRd—, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted cycloalkylakyl, substituted or unsubstituted cycloalkenyl, substituted or unsubstituted heterocylyl, substituted or unsubstituted heterocyclylalkyl, substituted or unsubstituted aryl, substituted or unsubstituted arylalkyl, substituted or unsubstituted heteroaryl, and substituted or unsubstituted heteroarylalkyl, or when Ra and Rb substitutent are directly bound to the same atom, they may be joined to form a substituted or unsubstituted saturated or unsaturated 3-10 member ring, which may optionally include one or more heteroatoms which may be same or different and are selected from O, NRc and S;\neach occurrence of R c and Rd may be same or different and are independently selected from hydrogen, nitro, hydroxy, cyano, halogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted cycloalkylakyl, substituted or unsubstituted cycloalkenyl, substituted or unsubstituted heterocyclic group, substituted or unsubstituted heterocyclylalkyl, or when two Rc and/or Rd substitutents are directly bound to the same atom, they may be joined to form a substituted or unsubstituted saturated or unsaturated 3-10 member ring, which may optionally include one or more heteroatoms which are the same or different and are selected from O, NH and S;\neach occurrence of Y is selected from O, S and —NR a; and\neach occurrence of q independently represents 0, 1 or 2. \n12. A compound of claim 11, wherein one of R1 and R2 is CF3 and the other is cyclopropyl.\n13. A compound of claim 11, wherein one of R1 and R2 is CF3 and the other is CH2F, CHF2.\n14. A compound of claim 11, wherein both R1 and R2 represent cyclopropyl.\n15. A compound of claim 11, wherein Cy is selected from\n\n16. A compound selected from:  \nN-[6-(3,5-dicyclopropyl-1H-pyrazol-1-yl)pyridin-3-yl]-2-fluorobenzamide \nN-[6-(3,5-dicyclopropyl-1H-pyrazol-1-yl)pyridin-3-yl]-2,3-difluorobenzamide \nN-[6-(3,5-dicyclopropyl-1H-pyrazol-1-yl)pyridin-3-yl]-2,6-difluorobenzamide \nN-{6-[5-cyclopropyl-3-(trifluoromethyl)-1H-pyrazol-1-yl]pyridin-3-yl}-2-methylbenzamide \n2-chloro-N-6-[5-cyclopropyl-3-(trifluoromethyl)-1H-pyrazol-1-yl]pyridin-3-yl 1 benzamide \nN-(6-(5-cyclopropyl-3-(trifluoromethyl)-1H-pyrazol-1-yl)pyridin-3-yl)-2-fluorobenzamide \nN-{6-[5-cyclopropyl-3-(trifluoromethyl)-1H-pyrazol-1-yl]pyridin-3-yl}-2,3-difluorobenzamide \nN-{6-[5-cyclopropyl-3-(trifluoromethyl)-1H-pyrazol-1-yl]pyridin-3-yl}-2,6-difluorobenzamide \n or a tautomer, prodrug, N-oxide, pharmaceutically acceptable ester, or pharmaceutically acceptable salt thereof. \n17. A pharmaceutical composition, comprising a compound of claim 1 and a pharmaceutically acceptable carrier.\n18. N-(6-(5-cyclopropyl-3-(trifluoromethyl)-1H-pyrazol-1-yl)pyridin-3-yl)-2-methylbenzamide or a pharmaceutically acceptable salt thereof.\n19. A pharmaceutical composition comprising a compound of claim 18 and a pharmaceutically acceptable carrier.\n20. N-(6-(5-cyclopropyl-3-(trifluoromethyl)-1H-pyrazol-1-yl)pyridin-3-yl)-2-methylbenzamide.\n21. A pharmaceutical composition comprising a compound of claim 20 and a pharmaceutically acceptable carrier.\n22. A method of treating asthma comprising the step of administering to a subject in need thereof an effective amount of a compound of claim 1.\n23. A method of treating rheumatoid arthritis comprising the step of administering to a subject in need thereof an effective amount of a compound of claim 1.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  1
The invention claimed is: \n1. A method for preparing a composition comprising nonlive Lactobacillus with specific binding ability for Streptococcus mutans, comprising the following steps: \ni) warming a suspension of cells of a  Lactobacillus or a mixture of Lactobacilli with specific binding ability to Streptococcus mutans from a starting temperature of below 40° C. to a pasteurization temperature of 75 to 85° C. with a temperature change of 0.5 to 2° C./min, where the specific binding \na) is resistant to heat treatment; \nb) is resistant to protease treatment; \nc) is calcium-dependent; \nd) takes place in a pH range of between 4.5 and 8.5; and/or \ne) takes place in the presence of saliva, \nii) holding the warm suspension at the pasteurization temperature over a period of 20 to 40 min, \niii) cooling the suspension held in step ii) to a final temperature of below 40° C., with a temperature change of 0.5 to 2° C./min. \n2. The method according to claim 1, wherein the Lactobacillus cells are selected from the group consisting of cells of strains of Lactobacillus paracasei, cells of strains of Lactobacillus rhamnosus, and a mixture thereof.\n3. The method according to claim 1, wherein the Lactobacillus cells are selected from the group consisting of cells of Lactobacillus paracasei, and cells of Lactobacillus rhamnosus. \n4. The method according to claim 1, wherein the Lactobacillus cells have a specific binding ability for Streptococcus mutans Serotype c (DSMZ 20523), Serotype e (NCTC 10923), and/or Serotype F (NCTC 11060).\n5. The method according to claim 1, wherein the pasteurization temperature in step i) is from 78 to 80° C.\n6. The method according to claim 1, wherein the temperature change in step i) and/or iii) is from 0.8 to 1.2° C./min.\n7. The method according to claim 1, wherein in step i) the suspension comprises not more than 10 mmol glucose/1.\n8. The method according to claim 1, further comprising the following steps: \niv) treating the suspension obtained in step iii) with a carrier to obtain a spray-drying mixture, the carrier being selected from the group consisting of alkali metal sulfates and alkaline-earth metal sulfates, wherein the amount of carrier is chosen such that the spray-drying mixture has a dry-matter content of 10 to 30% by weight and; \nv) spray-drying the spray-drying mixture obtained in step iv). \n9. The method according to claim 8, wherein the spray-drying is effected at a gas inlet temperature of a spray-drying gas employed for drying of from 180 to 250° C., and a gas outlet temperature from a zone provided for drying of from 70 to 100° C., and the average residence time in the zone is from 10 to 60 seconds.\n10. The method according to claim 1, wherein the Lactobacillus cells are selected from the group consisting of the deposited strains DSMZ 16667, DSMZ 16668, DSMZ 16669, DSMZ 16670, DSMZ 16671, DSMZ 16672 and DSMZ 16673.\n11. The method according to claim 8, wherein the spray-drying is performed in a spray tower.\n12. The method according to claim 8, wherein the gas outlet temperature is 85° C.\n13. The method according to claim 8, wherein the average residence time in the zone is from 20 to 40 seconds.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         1
The invention claimed is: \n1. A composition comprising a modified polymer comprising: \nat least one branched modified polymer macromolecule comprising at least one of structures (ib1), (ib2), (ib3), or (ib4); and \nat least one linear modified polymer macromolecule comprising the structure (iib1); \nwherein the at least one branched modified polymer macromolecule and the at least one linear modified polymer macromolecule each, independently comprises at least one amine group selected from the group consisting of: \n\n and combinations thereof;  \nwhere \nN is a nitrogen atom; \nC is carbon atom; \nH is a hydrogen atom; \nE is selected from the group consisting of (i) a (C 1-C18) alkylene which is substituted with an amine group which is a tertiary amine, R39R40R41Si— or R39R40R41Si— amine group, (C6-C18) aryl or (C7-C18)aralkyl; (ii) tertiary amine group; (iii) R42R43R44SiN group; (iv) an oxygen atom (O); (v) a sulfur atom (S); (vi) N—CHR8—CR9?CR10; (vii) N—CHR8—C?CHR10; (viii) N—CR8—CR9?CHR10; (ix) N—CHR8—CR9?CHR10; and (x) H—N group,\nwhere  \nR 39, R40 and R41 are each independently selected from the group consisting of (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl;\nR 42, R43 and R44 are each independently selected from the group consisting of (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl;\nR 6 is (C1-C18) alkyl which is substituted with a tertiary amine group or a (R45R46R47Si)2N group; \nR 45, R46 and R47 are each independently selected from the group consisting of (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl;\nR 7 is selected from the group consisting of hydrogen, (C1-C18) alkyl, (C6-C18) aryl, (C7-C18) aralkyl, —CHR8—CR9?CHR10, and —SiR21R22R23; \nR 21, R22 and R23 are each independently selected from the group consisting of (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl;\nR 8, R9, R10 are each independently selected from the group consisting of hydrogen, (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl;\nR 11 and R12 are each at least divalent, and are each independently selected from the group consisting of (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl;\na is the number 2; and \nb is the number 0; and \n where  \n(ib1) is a four valent silicon or tin atom selected from the group consisting of (R??) tM group, a (R??)tM(X)p group, and a M(X)z—(O)x-M(X)z group, wherein \nM is a tin or a silicon atom; \nO is an oxygen atom; \nX is a halide atom, an alkoxy group or a hydroxyl group (—OH group); \nR?? is a (C 1-C6)-alkyl group;\nz is the number 2; \nx is the number 0 or 1; \nt is the number 0 or 1; \np is the number 1 or 2; and \nwherein the remaining free valences on M are each linked to an alpha-modified polymer macromolecule; \n(ib2) is a group of Formula 2A:  \n\n(R 24O)q(R25)rSi—R29—S—Si?R26R27R28??Formula 2A;\n(ib3) a group of Formula 2B:  \n\n(R 24O)q(R25)rSi—R29—S—H??Formula 2B\n(ib4) is a group of Formula 2C:  \n\n(R 30O)s(R31)tSi—R35—N(H)u(Si?R32R33R34)v??Formula 2C,\n(iib1) is a tertiary amine group of Formula 3A: \n\n wherein,  \nSi and Si? are each silicon atoms; \nS is a sulfur atom; \nO is an oxygen atom; \nR? is selected from the group consisting of alkyl, aryl and aralkyl; \nR 13, R14 are the same or different and are each independently hydrogen or alkyl;\nR 15, R16 and R17 are the same or different and each independently selected from the group consisting of hydrogen, alkyl, aryl and aralkyl;\nR 24 is hydrogen or (C1-C6) alkyl;\nR 25, R26, R27 and R28 are each independently selected from the group consisting of hydrogen, (C1-C18) alkyl, (C1-C18) alkoxy, (C6-C18) aryl, and (C7-C18) aralkyl;\nR 29 is a divalent group selected from the group consisting of di-(C2-C20) alkylether (alkyl-O-alkyl), a (C6-C18) aryl, a (C7-C18) alkylaryl, and a (C1-C18) alkyl; \nwhere R 29 may be substituted with a substituent selected from the group consisting of a (C1-C4) alkyl, a (C1-C4) alkoxy, a (C7-C16) aryl, a (C7-C16) aralkyl, a nitrile, an amine, —NO2, and a thioalkyl;\nR 30 is hydrogen or (C1-C6) alkyl;\nR 31, R32, R33 and R34 are each independently selected from the group consisting of hydrogen, (C1-C18) alkyl, (C1-C18) alkoxy, (C6-C18) aryl, and (C7-C18) aralkyl;\nR 35 is a divalent group selected from the group consisting of a di-(C2-C20) alkylether (alkyl-O-alkyl), an (C6-C18) aryl, a (C7-C18) alkylaryl, and a (C1-C18) alkyl; \nwhere R 35 may be substituted with a substituent selected from the group consisting of a (C1-C4) alkyl, a (C1-C4) alkoxy, a (C7-C16) aryl, a (C7-C16) aralkyl, a nitrile, an amine, —NO2, and a thioalkyl;\nq is the number 0 or 1; \nr is the number 0 or 1; \nq+r is 0 or 1; \ns is the number 0 or 1; \nt is the number 0 or 1; \ns+t is the number 0 or 1; \nu is the number 0, 1 or 2; \nv is the number 0, 1 or 2; \nu+v is 2; \nw is the number 0 or 1; \nx is the number 0 or 1; \nw+x=1; and \nthe remaining free valences of the four valent silicon atom are each linked to an alpha-modified polymer macromolecule. \n2. The composition of claim 1, wherein the amine group is selected from the group consisting of Formula 1D, Formula 1E, and Formula 1F.\n3. The composition of claim 2, wherein E is a (C1-C18) alkylene which is substituted with a tertiary amine group or a R39R40R41SiN group.\n4. The composition of claim 2, wherein E is an oxygen atom (O) or a sulfur atom (S).\n5. The composition of claim 2, wherein E is N—CHR8—CR9?CR10, N—CHR8—C?CHR10, N—CR8—CR9?CHR10 or N—CHR8—CR9?CHR10.\n6. The composition of claim 2, wherein E is an H—N group or a R42R43R44SiN group.\n7. The composition of claim 1, further comprising an oil.\n8. The composition of claim 1, wherein the composition further comprises a filler.\n9. The composition of claim 1, wherein the at least one branched modified polymer macromolecule and the at least one linear modified polymer macromolecule each independently comprise a monomer unit derived from at least one monomer selected from the group consisting of butadiene, isoprene, styrene, alpha-methylstyrene, and combinations thereof.\n10. The composition of claim 1, wherein the composition further comprises a polymer selected from the group consisting of polybutadiene, butadiene-styrene copolymers, butadiene-isoprene copolymers, polyisoprene, and butadiene-styrene-isoprene terpolymers.\n11. An article comprising at least one component formed from the composition of claim 1, wherein the article is selected from the group consisting of a tire, a tire tread, a tire side wall, a tire carcass, a belt, a hose, a vibration damper, and a footwear component.\n12. An article comprising at least one component formed from a vulcanized composition comprising the reaction product of the composition of claim 1 with a filler or a vulcanizing agent.\n13. The article of claim 12, wherein the article is selected from the group consisting of a tire, a tire tread, a tire side wall, a tire carcass, a belt, a hose, a vibration damper, and a footwear component.\n14. A method for making a modified polymer, comprising:\n A) reacting an amine polymerization initiator with a monomer in a polymerization solvent to form Composition A; where the amine polymerization initiator is selected from the group consisting of: \n\n where  \nM is lithium, sodium or potassium; \nN is a nitrogen atom; \nC is carbon atom; \nH is a hydrogen atom; \nE is selected from the group consisting of (C 1-C18) alkylene which is substituted with an amine group which is a tertiary amine, (C7-C18) aralkylene, an oxygen atom (O), a sulfur atom (S), N—CHR8—CR9?C(M)R10, N—CHR8—C(M)?CHR10, N—C(M)R8—CR9?CHR10, and N—CHR8—CR9?CHR10;\nR 6 is (C1-C18) alkyl;\nR 7 is selected from the group consisting of hydrogen, (C1-C18) alkyl, (C6-C18) aryl, (C7-C18) aralkyl, —CHR8—CR9?CHR10, and —SiR36R37R38; \nwhere R 36, R37 and R38 are each independently selected from the group consisting of (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl;\nR 8, R9, R10, R11 and R12are each independently selected from the group consisting of (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl;\na is the number 2; and \nb is the number zero; and \n the monomer is selected from the group consisting of butadiene, styrene, isoprene, and combinations thereof; \n B) reacting Composition A with at least one coupling agent selected from the group consisting of SnCl 4, (R1)3SnCl, (R1)2SnCl2, R1SnCl3, SiCl4, (R1)3SiCl, (R1)2SiCl2, R1SiCl3, Cl3Si—SiCl3, Cl3Si—O—SiCl3, Cl3Sn—SnCl3, Cl3Sn—O—SnCl3, Sn(OMe)4, Si(OMe)4, Sn(OEt)4, Si(OEt)4, (R24O)q(R25)rSi—R29—S—Si?R26R27R28 (Formula 2A), (R30O)s(R31)tSi—R35—N(H)u(Si?R32R33R34)v (Formula 2C), and combinations thereof, to form Composition B, \nwhere R 1 is a hydrocarbyl group;\nSi and Si? are silicon atoms; \nS is a sulfur atom; \nN is a nitrogen atom; \nO is an oxygen atom; \nH is a hydrogen atom; \nR 24 and R30 are each independently hydrogen (H), or (C1-C6) alkyl;\nR 25, R26, R27, R28, R31, R32, R33 and R34 are the same or different, and are each independently selected from the group consisting of: hydrogen (H), (C1-C18) alkyl, (C1-C18) alkoxy, (C6-C18) aryl, and (C7-C18) aralkyl;\nR 29 and R35 are each divalent groups selected from the group consisting of a di-(C2-C20)alkylether (alkyl-O-alkyl), an (C6-C18) aryl, a (C7-C18) alkylaryl, and a (C1-C18) alkyl; where each R29 and R35 group may independently be substituted with at least one substituent selected from the group consisting of (C1-C4) alkyl, (C1-C4) alkoxy, (C7-C16) aryl, (C7-C16) aralkyl, amine, and thioalkyl;\nq and s are independently the number 2 or 3; \nr and u are independently the number 0 or 1; \nq+r=3; s+t=3 and \nu+v=2; \n C) reacting Composition B with at least one chain-end modifying agent of Formula 3B to form the modified polymer; \n\nwhere \nC is a carbon atom; \nO is an oxygen atom; \nN is a nitrogen atom; \nH is a hydrogen atom; \nR 15, R16 and R17 are the same or different, and are each, independently, hydrogen or hydrocarbyl groups, where the hydrocarbyl group may be each branched, saturated or unsaturated;\nR? is a hydrocarbyl group, where the hydrocarbyl group may be each branched, saturated or unsaturated. \n15. A composition comprising a modified polymer comprising: \nat least one branched modified polymer macromolecule comprising at least one of structures (ib1), (ib2), (ib3), or (ib4); and \nat least one linear modified polymer macromolecule comprising the structure (iib1); \nwherein the at least one branched modified polymer macromolecule and the at least one linear modified polymer macromolecule each, independently comprises at least one amine group selected from the group consisting of: \n\n and combinations thereof;  \nwhere \nN is a nitrogen atom; \nC is carbon atom; \nH is a hydrogen atom; \nE is selected from the group consisting of (i) a (C 1-C18) alkylene which is substituted with an amine group which is a tertiary amine, R39R40R41Si— or R39R40R41Si-amine group, (C6-C18) aryl or (C7-C18)aralkyl; (ii) tertiary amine group; (iii) R42R43R44SiN group; (iv) an oxygen atom (O); (v) a sulfur atom (S); (vi) N—CHR8—CR9?CR10; (vii) N—CHR8—C?CHR10; (viii) N—CR8—CR9?CHR10; (ix) N—CHR8—CR9?CHR10; and (x) H—N group,\nwhere  \nR 39, R40 and R41 are each independently selected from the group consisting of (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl;\nR 42, R43 and R44 are each independently selected from the group consisting of (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl;\nR 6 is selected from the group consisting of (i) —SiR36R37R38, (ii) (C1-C18) alkyl which is substituted with an amine group, R45R46R47Si group, or (R45R46R47Si)2N group, (iii) (C6-C18) aryl, (iv) (C7-C18) aralkyl, and (v) hydrogen, \nR 36, R37 and R38 are each independently selected from the group consisting of (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl;\nR 45, R46 and R47 are each independently selected from the group consisting of (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl;\nR 7 is selected from the group consisting of hydrogen, —CHR8—CR9?CHR10, and —SiR21R22R23; \nR 21, R22 and R23 are each independently selected from the group consisting of (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl;\nR 8, R9, R10 are each independently selected from the group consisting of hydrogen, (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl;\nR 11 and R12 are each at least divalent, and are each independently selected from the group consisting of (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl;\na is the number 1; and \nb is the number 1; and \nwhere \n(ib1) is a four valent silicon or tin atom selected from the group consisting of (R??) tM group, a (R??)tM(X)p group, and a M(X)z—(O)x-M(X)z group, wherein \nM is a tin or a silicon atom; \nO is an oxygen atom; \nX is a halide atom, an alkoxy group or a hydroxyl group (—OH group); \nR?? is a (C 1-C6)-alkyl group;\nz is the number 2; \nx is the number 0 or 1; \nt is the number 0 or 1; \np is the number 1 or 2; and \nwherein the remaining free valences on M are each linked to an alpha-modified polymer macromolecule; \n(ib2) is a group of Formula 2A:  \n\n(R 24O)q(R25)rSi—R29—S—Si?R26R27R28??Formula 2A;\n(ib3) a group of Formula 2B:  \n\n(R 24O)q(R25)rSi—R29—S—H??Formula 2B\n(ib4) is a group of Formula 2C:  \n\n(R 30O)s(R31)tSi—R35—N(H)u(Si?R32R33R34)v??Formula 2C,\n(iib1) is a tertiary amine group of Formula 3A: \n\n wherein,  \nSi and Si? are each silicon atoms; \nS is a sulfur atom; \nO is an oxygen atom; \nR? is selected from the group consisting of alkyl, aryl and aralkyl; \nR 13, R14 are the same or different and are each independently hydrogen or alkyl;\nR 15, R16 and R17 are the same or different and each independently selected from the group consisting of hydrogen, alkyl, aryl and aralkyl;\nR 24 is hydrogen or (C1-C6) alkyl;\nR 25, R26, R27 and R28 are each independently selected from the group consisting of hydrogen, (C1-C18) alkyl, (C1-C18) alkoxy, (C6-C18) aryl, and (C7-C18) aralkyl;\nR 29 is a divalent group selected from the group consisting of di-(C2-C20) alkylether (alkyl-O-alkyl), a (C6-C18) aryl, a (C7-C18) alkylaryl, and a (C1-C18) alkyl; \nwhere R 29 may be substituted with a substituent selected from the group consisting of a (C1-C4) alkyl, a (C1-C4) alkoxy, a (C7-C16) aryl, a (C7-C16) aralkyl,\na nitrile, an amine, —NO 2, and a thioalkyl;\nR 30 is hydrogen or (C1-C6) alkyl;\nR 31, R32, R33 and R34 are each independently selected from the group consisting of hydrogen, (C1-C18) alkyl, (C1-C18) alkoxy, (C6-C18) aryl, and (C7-C18) aralkyl;\nR 35 is a divalent group selected from the group consisting of a di-(C2-C20) alkylether (alkyl-O-alkyl), an (C6-C18) aryl, a (C7-C18) alkylaryl, and a (C1-C18) alkyl; \nwhere R 35 may be substituted with a substituent selected from the group consisting of a (C1-C4) alkyl, a (C1-C4) alkoxy, a (C7-C16) aryl, a (C7-C16) aralkyl,\na nitrile, an amine, —NO 2, and a thioalkyl;\nq is the number 0 or 1; \nr is the number 0 or 1; \nq+r is 0 or 1; \ns is the number 0 or 1; \nt is the number 0 or 1; \ns+t is the number 0 or 1; \nu is the number 0, 1 or 2; \nv is the number 0, 1 or 2; \nu+v is 2; \nw is the number 0 or 1; \nx is the number 0 or 1; \nw+x=1; and \n the remaining free valences of the four valent silicon atom are each linked to an alpha-modified polymer macromolecule.    1
What is claimed is: \n1. A method of selecting a candidate compound for use in the treatment of Alzheimer's disease in a human patient, which method comprises: \n(a) incubating proliferating lymphocytes of said patient in the presence of one or more pharmaceutical agent(s), wherein said proliferating lymphocytes exhibit a cell cycle regulatory defect at the G1/S phase transition and wherein said pharmaceutical agent(s) are: \ni) inhibitors of cell cycle re-entry or progression to the G1/S transition; or \nii) inhibitors of progression of the cell cycle through the G1/S transition point; and \n(b) screening and selecting a compound that corrects said regulatory defect at the G1/S transition in said proliferating lymphocytes as a candidate compound for use in the treatment of Alzheimer's disease in said patient. \n2. The method according to claim 1, wherein said one or more pharmaceutical agent(s) include(s): \n(A) one or more inhibitors of cell cycle re-entry or progression to the G1/S transition that is an inhibitor of the G0/G1 transition, or \n(B) one or more inhibitors of progression of the cell cycle through the G1/S transition point that blocks cell cycle progression in G1, induces cell cycle arrest in G1, induces cell cycle arrest at the G1/S checkpoint, blocks the G1/S transition or inhibits DNA synthesis. \n3. The method according to claim 2, wherein said one or more pharmaceutical agent(s) include(s) sodium valproate.\n4. The method according to claim 2, wherein said one or more pharmaceutical agent(s) include(s) a retinoid or retinoid receptor selective ligand, an ansamycin, a vitamin D analogue, a steroid or glucocorticoid, or an alpha adrenergic receptor antagonist.\n5. The method according to claim 1, wherein the pharmaceutical agent is an inhibitor of the G0/G1 transition.\n6. The method according to claim 1, wherein the pharmaceutical agent induces cell cycle arrest in the G0/G1 phase.\n7. The method according to claim 1, wherein the pharmaceutical agent is sodium valproate.\n8. The method according to claim 1, wherein the pharmaceutical agent blocks cell cycle progression in G1.\n9. The method according to claim 1, wherein the pharmaceutical agent induces cell cycle arrest in G1.\n10. The method according to claim 1, wherein the pharmaceutical agent induces cell cycle arrest at the G1/S checkpoint.\n11. The method according to claim 1, wherein the pharmaceutical agent blocks the G1/S transition.\n12. The method according to claim 1, wherein the pharmaceutical agent inhibits DNA synthesis.\n13. The method according to claim 1, wherein the pharmaceutical agent is: \n(a) a retinoid or retinoid receptor selective ligand; \n(b) an ansamycin; \n(c) a steroid or glucocorticoid; or \n(d) an alpha adrenergic receptor antagonist. \n14. The method according to claim 13, wherein the candidate pharmaceutical agent is alpha adrenergic receptor antagonist, and wherein said alpha adrenergic receptor antagonist is doxazosin.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                1
Name: Claims, Length: 2784, dtype: int64


First Claim
1. A steam cleaning appliance, comprising: \na steam generation unit; \na steam cleaning applicator; and \na flexible steam conduit configured to guide steam from the steam generation unit to a steam inlet for the steam cleaning applicator; \nwherein the steam cleaning applicator is connectable to the steam conduit; \nthe steam cleaning applicator is rotatable relative to the steam conduit in either rotational direction without loosening the connection of the steam applicator to the steam conduit; \nthe steam cleaning applicator has an end-to-end direction and \nthe steam cleaning applicator is rotatable by at least 360 degrees relative to the steam conduit in either rotational direction about the end-to-end direction of the steam cleaning applicator, without loosening the connection of the steam cleaning applicator to the steam conduit.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       1
1. A printed substrate manufacturing method of forming solder bumps on a plurality of electrode parts of a printed substrate and mounting a semiconductor chip on the printed substrate via the plurality of solder bumps, comprising: \npreparing a thermoplastic film to be used as an underfill that covers a surface of the printed substrate on which the solder bumps are formed, wherein parts of the film corresponding to the solder bumps are removed and a peripheral edge of a part of the film on which the semiconductor chip will be mounted has a protruded form for preventing movement of the semiconductor chip on the printed substrate; \ncovering the printed substrate with the film and thereafter bonding the film onto the printed substrate, wherein the parts of the film corresponding to the solder bumps are removed before covering the printed substrate with the film; \nmounting the semiconductor chip on the printed substrate and carrying the printed substrate into a reflow furnace; and \nbonding by applying heat and pressure to fuse the solder bumps in the reflow furnace.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               1
1. A system for filtering particulate matter from exhaust gas, said system comprising: \na porous structure having substrate pores of a first mean pore size; a selective catalytic reduction (SCR) washcoat disposed on a surface of the porous structure or within the porous structure to define pores of a second mean pore size; and the second mean pore size is less than the first mean pore size; \nwherein said washcoat comprises a small pore zeolite promoted with at least one metal selected from the group consisting of Cr, Co, Cu, Fe, Hf, La, Ce, In, V, Mn, Ni, Zn, Ga, Ag, Au, Pt, Pd, and Rh; \na NO xabsorber catalyst disposed upstream of the washcoat.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        1
1. A low back pain treatment tool comprising: \na cylindrical casing elongated in a longitudinal direction; \na coccyx contact treatment member which is placed through an elastic member so as to be slidably movable in an axial direction of the cylindrical casing; \na coccyx contact buffering member which is provided on an upper end of the coccyx contact treatment member; \na posture holding member which has a posture holding surface in a longitudinal direction, which faces the cylindrical casing; and \na handle fixed to which the posture holding member.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         1
1. A fail detecting device for a rotation angle sensor, comprising: \na cam with a continuously formed cam surface having an actuating surface for reciprocating a push rod and a non-actuating surface that does not reciprocate the push rod, \nan angle sensor formed of an endless rotary potentiometer for detecting a rotation angle of the cam and having an output voltage increasing in proportion to the rotational angle in a range of 360 degrees, and \na controller for detecting a fail state of the angle sensor, \nsaid cam is configured to be driven to rotate in one direction by an electric motor controlled by the controller and to reciprocate the push rod; \nthe output voltage of the angle sensor detects:  \na first region equal to or lower than a first predetermined voltage from 0 degrees to an angle ? 1, and\na second region equal to or higher than a second predetermined voltage higher than the first predetermined voltage from 360 degrees to an angle ? 2,\nsaid first and second regions being recognized as a dead zone; \nthe controller is configured to drive the rotation of the cam to a predetermined position in the non-actuating surface at a constant speed in transition of the cam surface of the cam abutting against the push rod from a side of the actuating surface to a side of the non-actuating surface; and \nthe angle sensor is configured wherein the dead zone is disposed at a position in the non-actuating surface of the cam and in an area in front of the predetermined position.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        1
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ..
1. A liquid hand dishwashing detergent composition comprising: \na. from about 2% to about 70% by weight of the composition of an ethoxylated anionic surfactant derived from a fatty alcohol, wherein:  \ni. at least about 90% by weight of said fatty alcohol is linear, and \nii. said fatty alcohol has an average degree of ethoxylation of from about 1 to about 2; and \nb. from about 0.1 to about 5% by weight of the composition of an ethoxylated branched nonionic surfactant, having an average degree of ethoxylation of about 8; \n wherein the total amount of surfactant is from about 10 to about 85% by weight of the liquid detergent composition, wherein said ethoxylated anionic surfactant is a saturated C 10-C14 alkyl ethoxysulphate and said ethoxylated branched nonionic surfactant is 3-propyl heptanol, wherein the degree of ethoxylation of said branched nonionic is greater than the degree of ethoxylation of said ethoxylated anionic surfactant.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                1
1. A compound of formula\n\n or a tautomer, prodrug, N-oxide, pharmaceutically acceptable ester or pharmaceutically acceptable salt thereof, wherein  \nRing Hy represents \n\n optionally substituted with R??;  \nR 1 and R2 are the same or different and are independently selected from CH3, CH2F, CHF2, CF3, substituted or unsubstituted C(3-5)cycloalkyl, CH2—ORa, CH2—NRaRb, CN and COOH with the proviso that;\na) both R 1 and R2 at the same time do not represent CF3,\nb) both R 1 and R2 at the same time do not represent CH3,\nc) when R 1 is CF3 then R2 is not CH3 and\nd) when R 1 is CH3 then R2 is not CF3;\nRing Ar represents: \n\nL 1 and L2 together represent —NH—C(?O)—;\nA is absent; \nR? and R? are the same or different and are independently selected from hydrogen, hydroxy, cyano, halogen, —OR a, —COORa, —S(?O)q—Ra, —NRaRb, —C(?X)—Ra, substituted or unsubstituted C(1-6) alkyl group, substituted or unsubstituted C(1-6) alkenyl, substituted or unsubstituted C(1-6) alkynyl, and substituted or unsubstituted C(3-5) cycloalkyl, or R? and R? may be joined to form a substituted or unsubstituted saturated or unsaturated 3-6 member ring, which may optionally include one or more heteroatoms which may be same or different and are selected from O, NRa and S;\nR?? is selected from hydrogen, hydroxy, cyano, halogen, —OR a, —COORa, —S(?O)q—Ra, —NRaRb, —C(?X)—Ra, substituted or unsubstituted C(1-6) alkyl group, substituted or unsubstituted C(1-6) alkenyl, substituted or unsubstituted C(1-6) alkynyl, and substituted or unsubstituted C(3-5)cycloalkyl\neach occurrence of X is independently selected from O, S and —NR a;\nCy is selected from monocyclic substituted or unsubstituted cycloalkyl group, and monocyclic substituted or unsubstituted aryl; \neach occurrence of R a and Rb are the same or different and are independently selected from hydrogen, nitro, hydroxy, cyano, halogen, —ORc, —S(?O)q—Rc, —NRcRd, —C(?Y)—Rc, —CRcRd—C(?Y)—Rc, —CRcRd—Y—CRcRd—, —C(?Y)—NRcRd—, —NRRd—C(?Y)—NRcRd—, —S(?O)q—NRcRd—, —NRcRd—S(?O)q—NRcRd—, —NRcRd—NRcRd—, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted cycloalkylakyl, substituted or unsubstituted cycloalkenyl, substituted or unsubstituted heterocylyl, substituted or unsubstituted heterocyclylalkyl, substituted or unsubstituted aryl, substituted or unsubstituted arylalkyl, substituted or unsubstituted heteroaryl, and substituted or unsubstituted heteroarylalkyl, or when Ra and Rb are directly bound to the same atom, they may be joined to form a substituted or unsubstituted saturated or unsaturated 3-10 member ring, which may optionally include one or more heteroatoms which may be the same or different and are selected from O, NRc and S;\neach occurrence of R c and Rd may be same or different and are independently selected from hydrogen, nitro, hydroxy, cyano, halogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted cycloalkylakyl, substituted or unsubstituted cycloalkenyl, substituted or unsubstituted heterocyclic group, substituted or unsubstituted heterocyclylalkyl, or when two Rc and/or Rd substitutents are directly bound to the same atom, they may be joined to form a substituted or unsubstituted saturated or unsaturated 3-10 member ring, which may optionally include one or more heteroatoms which are the same or different and are selected from O, NH and S;\neach occurrence of Y is selected from O, S and —NR a; and\neach occurrence of q independently represents 0, 1 or 2.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        1
1. A method for preparing a composition comprising nonlive Lactobacillus with specific binding ability for Streptococcus mutans, comprising the following steps: \ni) warming a suspension of cells of a  Lactobacillus or a mixture of Lactobacilli with specific binding ability to Streptococcus mutans from a starting temperature of below 40° C. to a pasteurization temperature of 75 to 85° C. with a temperature change of 0.5 to 2° C./min, where the specific binding \na) is resistant to heat treatment; \nb) is resistant to protease treatment; \nc) is calcium-dependent; \nd) takes place in a pH range of between 4.5 and 8.5; and/or \ne) takes place in the presence of saliva, \nii) holding the warm suspension at the pasteurization temperature over a period of 20 to 40 min, \niii) cooling the suspension held in step ii) to a final temperature of below 40° C., with a temperature change of 0.5 to 2° C./min.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            1
1. A composition comprising a modified polymer comprising: \nat least one branched modified polymer macromolecule comprising at least one of structures (ib1), (ib2), (ib3), or (ib4); and \nat least one linear modified polymer macromolecule comprising the structure (iib1); \nwherein the at least one branched modified polymer macromolecule and the at least one linear modified polymer macromolecule each, independently comprises at least one amine group selected from the group consisting of: \n\n and combinations thereof;  \nwhere \nN is a nitrogen atom; \nC is carbon atom; \nH is a hydrogen atom; \nE is selected from the group consisting of (i) a (C 1-C18) alkylene which is substituted with an amine group which is a tertiary amine, R39R40R41Si— or R39R40R41Si— amine group, (C6-C18) aryl or (C7-C18)aralkyl; (ii) tertiary amine group; (iii) R42R43R44SiN group; (iv) an oxygen atom (O); (v) a sulfur atom (S); (vi) N—CHR8—CR9?CR10; (vii) N—CHR8—C?CHR10; (viii) N—CR8—CR9?CHR10; (ix) N—CHR8—CR9?CHR10; and (x) H—N group,\nwhere  \nR 39, R40 and R41 are each independently selected from the group consisting of (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl;\nR 42, R43 and R44 are each independently selected from the group consisting of (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl;\nR 6 is (C1-C18) alkyl which is substituted with a tertiary amine group or a (R45R46R47Si)2N group; \nR 45, R46 and R47 are each independently selected from the group consisting of (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl;\nR 7 is selected from the group consisting of hydrogen, (C1-C18) alkyl, (C6-C18) aryl, (C7-C18) aralkyl, —CHR8—CR9?CHR10, and —SiR21R22R23; \nR 21, R22 and R23 are each independently selected from the group consisting of (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl;\nR 8, R9, R10 are each independently selected from the group consisting of hydrogen, (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl;\nR 11 and R12 are each at least divalent, and are each independently selected from the group consisting of (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl;\na is the number 2; and \nb is the number 0; and \n where  \n(ib1) is a four valent silicon or tin atom selected from the group consisting of (R??) tM group, a (R??)tM(X)p group, and a M(X)z—(O)x-M(X)z group, wherein \nM is a tin or a silicon atom; \nO is an oxygen atom; \nX is a halide atom, an alkoxy group or a hydroxyl group (—OH group); \nR?? is a (C 1-C6)-alkyl group;\nz is the number 2; \nx is the number 0 or 1; \nt is the number 0 or 1; \np is the number 1 or 2; and \nwherein the remaining free valences on M are each linked to an alpha-modified polymer macromolecule; \n(ib2) is a group of Formula 2A:  \n\n(R 24O)q(R25)rSi—R29—S—Si?R26R27R28??Formula 2A;\n(ib3) a group of Formula 2B:  \n\n(R 24O)q(R25)rSi—R29—S—H??Formula 2B\n(ib4) is a group of Formula 2C:  \n\n(R 30O)s(R31)tSi—R35—N(H)u(Si?R32R33R34)v??Formula 2C,\n(iib1) is a tertiary amine group of Formula 3A: \n\n wherein,  \nSi and Si? are each silicon atoms; \nS is a sulfur atom; \nO is an oxygen atom; \nR? is selected from the group consisting of alkyl, aryl and aralkyl; \nR 13, R14 are the same or different and are each independently hydrogen or alkyl;\nR 15, R16 and R17 are the same or different and each independently selected from the group consisting of hydrogen, alkyl, aryl and aralkyl;\nR 24 is hydrogen or (C1-C6) alkyl;\nR 25, R26, R27 and R28 are each independently selected from the group consisting of hydrogen, (C1-C18) alkyl, (C1-C18) alkoxy, (C6-C18) aryl, and (C7-C18) aralkyl;\nR 29 is a divalent group selected from the group consisting of di-(C2-C20) alkylether (alkyl-O-alkyl), a (C6-C18) aryl, a (C7-C18) alkylaryl, and a (C1-C18) alkyl; \nwhere R 29 may be substituted with a substituent selected from the group consisting of a (C1-C4) alkyl, a (C1-C4) alkoxy, a (C7-C16) aryl, a (C7-C16) aralkyl, a nitrile, an amine, —NO2, and a thioalkyl;\nR 30 is hydrogen or (C1-C6) alkyl;\nR 31, R32, R33 and R34 are each independently selected from the group consisting of hydrogen, (C1-C18) alkyl, (C1-C18) alkoxy, (C6-C18) aryl, and (C7-C18) aralkyl;\nR 35 is a divalent group selected from the group consisting of a di-(C2-C20) alkylether (alkyl-O-alkyl), an (C6-C18) aryl, a (C7-C18) alkylaryl, and a (C1-C18) alkyl; \nwhere R 35 may be substituted with a substituent selected from the group consisting of a (C1-C4) alkyl, a (C1-C4) alkoxy, a (C7-C16) aryl, a (C7-C16) aralkyl, a nitrile, an amine, —NO2, and a thioalkyl;\nq is the number 0 or 1; \nr is the number 0 or 1; \nq+r is 0 or 1; \ns is the number 0 or 1; \nt is the number 0 or 1; \ns+t is the number 0 or 1; \nu is the number 0, 1 or 2; \nv is the number 0, 1 or 2; \nu+v is 2; \nw is the number 0 or 1; \nx is the number 0 or 1; \nw+x=1; and \nthe remaining free valences of the four valent silicon atom are each linked to an alpha-modified polymer macromolecule.    1
1. A method of selecting a candidate compound for use in the treatment of Alzheimer's disease in a human patient, which method comprises: \n(a) incubating proliferating lymphocytes of said patient in the presence of one or more pharmaceutical agent(s), wherein said proliferating lymphocytes exhibit a cell cycle regulatory defect at the G1/S phase transition and wherein said pharmaceutical agent(s) are: \ni) inhibitors of cell cycle re-entry or progression to the G1/S transition; or \nii) inhibitors of progression of the cell cycle through the G1/S transition point; and \n(b) screening and selecting a compound that corrects said regulatory defect at the G1/S transition in said proliferating lymphocytes as a candidate compound for use in the treatment of Alzheimer's disease in said patient.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         1
Name: First Claim, Length: 2784, dtype: int64


Independent Claims
1. A steam cleaning appliance, comprising:  a steam generation unit; a steam cleaning applicator; and a flexible steam conduit configured to guide steam from the steam generation unit to a steam inlet for the steam cleaning applicator; wherein the steam cleaning applicator is connectable to the steam conduit; the steam cleaning applicator is rotatable relative to the steam conduit in either rotational direction without loosening the connection of the steam applicator to the steam conduit; the steam cleaning applicator has an end-to-end direction and the steam cleaning applicator is rotatable by at least 360 degrees relative to the steam conduit in either rotational direction about the end-to-end direction of the steam cleaning applicator, without loosening the connection of the steam cleaning applicator to the steam conduit.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 1
1. A printed substrate manufacturing method of forming solder bumps on a plurality of electrode parts of a printed substrate and mounting a semiconductor chip on the printed substrate via the plurality of solder bumps, comprising:  preparing a thermoplastic film to be used as an underfill that covers a surface of the printed substrate on which the solder bumps are formed, wherein parts of the film corresponding to the solder bumps are removed and a peripheral edge of a part of the film on which the semiconductor chip will be mounted has a protruded form for preventing movement of the semiconductor chip on the printed substrate; covering the printed substrate with the film and thereafter bonding the film onto the printed substrate, wherein the parts of the film corresponding to the solder bumps are removed before covering the printed substrate with the film; mounting the semiconductor chip on the printed substrate and carrying the printed substrate into a reflow furnace; and bonding by applying heat and pressure to fuse the solder bumps in the reflow furnace. | 2. A method of manufacturing a printed substrate comprising steps of:  preparing an underfill film by forming a plurality of holes through the film and forming at least one protruded form on a peripheral edge of the film, wherein the at least one protruded form is disposed on a first surface of the film, and the at least one protruded form extends away from the first surface of the film; after preparing the film, covering a printed substrate with the film by aligning a plurality of solder bumps on the printed substrate with the plurality of holes through the film and thereafter bonding the film onto the printed substrate; placing a semiconductor chip on the printed substrate via the plurality of solder bumps and carrying the printed substrate into a reflow furnace; and applying heat and pressure in the reflow furnace to adhere the semiconductor chip to the printed substrate.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         1
1. A system for filtering particulate matter from exhaust gas, said system comprising:  a porous structure having substrate pores of a first mean pore size; a selective catalytic reduction (SCR) washcoat disposed on a surface of the porous structure or within the porous structure to define pores of a second mean pore size; and the second mean pore size is less than the first mean pore size; wherein said washcoat comprises a small pore zeolite promoted with at least one metal selected from the group consisting of Cr, Co, Cu, Fe, Hf, La, Ce, In, V, Mn, Ni, Zn, Ga, Ag, Au, Pt, Pd, and Rh; a NO x absorber catalyst disposed upstream of the washcoat.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         1
1. A low back pain treatment tool comprising:  a cylindrical casing elongated in a longitudinal direction; a coccyx contact treatment member which is placed through an elastic member so as to be slidably movable in an axial direction of the cylindrical casing; a coccyx contact buffering member which is provided on an upper end of the coccyx contact treatment member; a posture holding member which has a posture holding surface in a longitudinal direction, which faces the cylindrical casing; and a handle fixed to which the posture holding member. | 4. A low back pain treatment tool comprising:  a cylindrical casing elongated in a longitudinal direction; a coccyx contact treatment member which is slidably placed through an elastic member in an axial direction of the cylindrical casing; a coccyx contact buffering member which is provided on an upper end of the coccyx contact treatment member; a posture holding member having a posture holding surface in a longitudinal direction, which faces the cylindrical casing; a handle fixed to the posture holding member; a horizontal seat plate which fixes and supports the cylindrical casing on the posture holding member by being fixed vertically with respect to the posture holding surface and coupling a lower end of the cylindrical casing to an upper surface of the horizontal seat plate; a horizontal base plate which fixes the posture holding member; a pair of left and right side plates which are fixed orthogonally to a horizontal surface of the base plate and the posture holding surface, and which support left and right sides of the horizontal base plate respectively; corner portions formed by an outer surface of either of the side plates, the posture holding surface, and a horizontal surface of the base plate; and rectangular parallelepiped foot rest blocks which are detachably placed at the corner portions.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 1
1. A fail detecting device for a rotation angle sensor, comprising:  a cam with a continuously formed cam surface having an actuating surface for reciprocating a push rod and a non-actuating surface that does not reciprocate the push rod, an angle sensor formed of an endless rotary potentiometer for detecting a rotation angle of the cam and having an output voltage increasing in proportion to the rotational angle in a range of 360 degrees, and a controller for detecting a fail state of the angle sensor, said cam is configured to be driven to rotate in one direction by an electric motor controlled by the controller and to reciprocate the push rod; the output voltage of the angle sensor detects:  a first region equal to or lower than a first predetermined voltage from 0 degrees to an angle ? 1 , and a second region equal to or higher than a second predetermined voltage higher than the first predetermined voltage from 360 degrees to an angle ? 2 , said first and second regions being recognized as a dead zone; the controller is configured to drive the rotation of the cam to a predetermined position in the non-actuating surface at a constant speed in transition of the cam surface of the cam abutting against the push rod from a side of the actuating surface to a side of the non-actuating surface; and the angle sensor is configured wherein the dead zone is disposed at a position in the non-actuating surface of the cam and in an area in front of the predetermined position. | 11. A fail detecting device for a rotation angle sensor comprising:  a cam having a continuously formed cam surface with an actuating surface for imparting motion to reciprocates a push rod and a non-actuating surface that does not impart motion to reciprocate the push rod; an angle sensor formed of an endless rotary potentiometer for detecting an angle of rotation of the cam and having an output voltage increasing in proportion to the rotational angle in a range of 360 degrees; a controller for detecting a fail state of the angle sensor; said cam being configured to be driven to rotate in one direction by a motor controlled by the controller to reciprocate the push rod; and the output voltage of the angle sensor detects:  a first region equal to or lower than a first predetermined voltage from 0 degrees to an angle ? 1 , and a second region equal to or higher than a second predetermined voltage higher than the first predetermined voltage from 360 degrees to an angle ? 2 , said dead zone is defined by the first and second regions; said controller being configured to drive the rotation of the cam to a predetermined position relative to the non-actuating surface at a constant speed in transition of the cam surface of the cam abutting against the push rod from a side of the actuating surface to a side of the non-actuating surface; said angle sensor being configured wherein the dead zone is disposed at a position in the non-actuating surface of the cam and in an area in front of the predetermined position.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          1
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ..
1. A liquid hand dishwashing detergent composition comprising:  a. from about 2% to about 70% by weight of the composition of an ethoxylated anionic surfactant derived from a fatty alcohol, wherein:  i. at least about 90% by weight of said fatty alcohol is linear, and ii. said fatty alcohol has an average degree of ethoxylation of from about 1 to about 2; and b. from about 0.1 to about 5% by weight of the composition of an ethoxylated branched nonionic surfactant, having an average degree of ethoxylation of about 8;  wherein the total amount of surfactant is from about 10 to about 85% by weight of the liquid detergent composition, wherein said ethoxylated anionic surfactant is a saturated C 10 -C 14  alkyl ethoxysulphate and said ethoxylated branched nonionic surfactant is 3-propyl heptanol, wherein the degree of ethoxylation of said branched nonionic is greater than the degree of ethoxylation of said ethoxylated anionic surfactant.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   1
1. A compound of formula  or a tautomer, prodrug, N-oxide, pharmaceutically acceptable ester or pharmaceutically acceptable salt thereof, wherein  Ring Hy represents  optionally substituted with R??;  R 1  and R 2  are the same or different and are independently selected from CH 3 , CH 2 F, CHF 2 , CF 3 , substituted or unsubstituted C (3-5) cycloalkyl, CH 2 —OR a , CH 2 —NR a R b , CN and COOH with the proviso that; a) both R 1  and R 2  at the same time do not represent CF 3 , b) both R 1  and R 2  at the same time do not represent CH 3 , c) when R 1  is CF 3  then R 2  is not CH 3  and d) when R 1  is CH 3  then R 2  is not CF 3 ; Ring Ar represents: L 1  and L 2  together represent —NH—C(?O)—; A is absent; R? and R? are the same or different and are independently selected from hydrogen, hydroxy, cyano, halogen, —OR a , —COOR a , —S(?O) q —R a , —NR a R b , —C(?X)—R a , substituted or unsubstituted C (1-6)  alkyl group, substituted or unsubstituted C (1-6)  alkenyl, substituted or unsubstituted C (1-6)  alkynyl, and substituted or unsubstituted C (3-5)  cycloalkyl, or R? and R? may be joined to form a substituted or unsubstituted saturated or unsaturated 3-6 member ring, which may optionally include one or more heteroatoms which may be same or different and are selected from O, NR a  and S; R?? is selected from hydrogen, hydroxy, cyano, halogen, —OR a , —COOR a , —S(?O) q —R a , —NR a R b , —C(?X)—R a , substituted or unsubstituted C (1-6)  alkyl group, substituted or unsubstituted C (1-6)  alkenyl, substituted or unsubstituted C (1-6)  alkynyl, and substituted or unsubstituted C (3-5) cycloalkyl each occurrence of X is independently selected from O, S and —NR a ; Cy is selected from monocyclic substituted or unsubstituted cycloalkyl group, and monocyclic substituted or unsubstituted aryl; each occurrence of R a  and R b  are the same or different and are independently selected from hydrogen, nitro, hydroxy, cyano, halogen, —OR c , —S(?O) q —R c , —NR c R d , —C(?Y)—R c , —CR c R d —C(?Y)—R c , —CR c R d —Y—CR c R d —, —C(?Y)—NR c R d —, —NRR d —C(?Y)—NR c R d —, —S(?O) q —NR c R d —, —NR c R d —S(?O) q —NR c R d —, —NR c R d —NR c R d —, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted cycloalkylakyl, substituted or unsubstituted cycloalkenyl, substituted or unsubstituted heterocylyl, substituted or unsubstituted heterocyclylalkyl, substituted or unsubstituted aryl, substituted or unsubstituted arylalkyl, substituted or unsubstituted heteroaryl, and substituted or unsubstituted heteroarylalkyl, or when R a  and R b  are directly bound to the same atom, they may be joined to form a substituted or unsubstituted saturated or unsaturated 3-10 member ring, which may optionally include one or more heteroatoms which may be the same or different and are selected from O, NR c  and S; each occurrence of R c  and R d  may be same or different and are independently selected from hydrogen, nitro, hydroxy, cyano, halogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted cycloalkylakyl, substituted or unsubstituted cycloalkenyl, substituted or unsubstituted heterocyclic group, substituted or unsubstituted heterocyclylalkyl, or when two R c  and/or R d  substitutents are directly bound to the same atom, they may be joined to form a substituted or unsubstituted saturated or unsaturated 3-10 member ring, which may optionally include one or more heteroatoms which are the same or different and are selected from O, NH and S; each occurrence of Y is selected from O, S and —NR a ; and each occurrence of q independently represents 0, 1 or 2. | 16. A compound selected from:  N-[6-(3,5-dicyclopropyl-1H-pyrazol-1-yl)pyridin-3-yl]-2-fluorobenzamide N-[6-(3,5-dicyclopropyl-1H-pyrazol-1-yl)pyridin-3-yl]-2,3-difluorobenzamide N-[6-(3,5-dicyclopropyl-1H-pyrazol-1-yl)pyridin-3-yl]-2,6-difluorobenzamide N-{6-[5-cyclopropyl-3-(trifluoromethyl)-1H-pyrazol-1-yl]pyridin-3-yl}-2-methylbenzamide 2-chloro-N-6-[5-cyclopropyl-3-(trifluoromethyl)-1H-pyrazol-1-yl]pyridin-3-yl 1 benzamide N-(6-(5-cyclopropyl-3-(trifluoromethyl)-1H-pyrazol-1-yl)pyridin-3-yl)-2-fluorobenzamide N-{6-[5-cyclopropyl-3-(trifluoromethyl)-1H-pyrazol-1-yl]pyridin-3-yl}-2,3-difluorobenzamide N-{6-[5-cyclopropyl-3-(trifluoromethyl)-1H-pyrazol-1-yl]pyridin-3-yl}-2,6-difluorobenzamide  or a tautomer, prodrug, N-oxide, pharmaceutically acceptable ester, or pharmaceutically acceptable salt thereof. | 18. N-(6-(5-cyclopropyl-3-(trifluoromethyl)-1H-pyrazol-1-yl)pyridin-3-yl)-2-methylbenzamide or a pharmaceutically acceptable salt thereof. | 20. N-(6-(5-cyclopropyl-3-(trifluoromethyl)-1H-pyrazol-1-yl)pyridin-3-yl)-2-methylbenzamide.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        1
1. A method for preparing a composition comprising nonlive  Lactobacillus  with specific binding ability for  Streptococcus mutans , comprising the following steps:  i) warming a suspension of cells of a  Lactobacillus  or a mixture of Lactobacilli with specific binding ability to  Streptococcus mutans  from a starting temperature of below 40° C. to a pasteurization temperature of 75 to 85° C. with a temperature change of 0.5 to 2° C./min, where the specific binding  a) is resistant to heat treatment; b) is resistant to protease treatment; c) is calcium-dependent; d) takes place in a pH range of between 4.5 and 8.5; and/or e) takes place in the presence of saliva, ii) holding the warm suspension at the pasteurization temperature over a period of 20 to 40 min, iii) cooling the suspension held in step ii) to a final temperature of below 40° C., with a temperature change of 0.5 to 2° C./min.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                1
1. A composition comprising a modified polymer comprising:  at least one branched modified polymer macromolecule comprising at least one of structures (ib1), (ib2), (ib3), or (ib4); and at least one linear modified polymer macromolecule comprising the structure (iib1); wherein the at least one branched modified polymer macromolecule and the at least one linear modified polymer macromolecule each, independently comprises at least one amine group selected from the group consisting of:  and combinations thereof;  where N is a nitrogen atom; C is carbon atom; H is a hydrogen atom; E is selected from the group consisting of (i) a (C 1 -C 18 ) alkylene which is substituted with an amine group which is a tertiary amine, R 39 R 40 R 41 Si— or R 39 R 40 R 41 Si— amine group, (C 6 -C 18 ) aryl or (C 7 -C 18 )aralkyl; (ii) tertiary amine group; (iii) R 42 R 43 R 44 SiN group; (iv) an oxygen atom (O); (v) a sulfur atom (S); (vi) N—CHR 8 —CR 9 ?CR 10 ; (vii) N—CHR 8 —C?CHR 10 ; (viii) N—CR 8 —CR 9 ?CHR 10 ; (ix) N—CHR 8 —CR 9 ?CHR 10 ; and (x) H—N group, where  R 39 , R 40  and R 41  are each independently selected from the group consisting of (C 1 -C 18 ) alkyl, (C 6 -C 18 ) aryl, and (C 7 -C 18 ) aralkyl; R 42 , R 43  and R 44  are each independently selected from the group consisting of (C 1 -C 18 ) alkyl, (C 6 -C 18 ) aryl, and (C 7 -C 18 ) aralkyl; R 6  is (C 1 -C 18 ) alkyl which is substituted with a tertiary amine group or a (R 45 R 46 R 47 Si) 2 N group;  R 45 , R 46  and R 47  are each independently selected from the group consisting of (C 1 -C 18 ) alkyl, (C 6 -C 18 ) aryl, and (C 7 -C 18 ) aralkyl; R 7  is selected from the group consisting of hydrogen, (C 1 -C 18 ) alkyl, (C 6 -C 18 ) aryl, (C 7 -C 18 ) aralkyl, —CHR 8 —CR 9 ?CHR 10 , and —SiR 21 R 22 R 23 ;  R 21 , R 22  and R 23  are each independently selected from the group consisting of (C 1 -C 18 ) alkyl, (C 6 -C 18 ) aryl, and (C 7 -C 18 ) aralkyl; R 8 , R 9 , R 10  are each independently selected from the group consisting of hydrogen, (C 1 -C 18 ) alkyl, (C 6 -C 18 ) aryl, and (C 7 -C 18 ) aralkyl; R 11  and R 12  are each at least divalent, and are each independently selected from the group consisting of (C 1 -C 18 ) alkyl, (C 6 -C 18 ) aryl, and (C 7 -C 18 ) aralkyl; a is the number 2; and b is the number 0; and  where  (ib1) is a four valent silicon or tin atom selected from the group consisting of (R??) t M group, a (R??) t M(X) p  group, and a M(X) z —(O) x -M(X) z  group, wherein  M is a tin or a silicon atom; O is an oxygen atom; X is a halide atom, an alkoxy group or a hydroxyl group (—OH group); R?? is a (C 1 -C 6 )-alkyl group; z is the number 2; x is the number 0 or 1; t is the number 0 or 1; p is the number 1 or 2; and wherein the remaining free valences on M are each linked to an alpha-modified polymer macromolecule; (ib2) is a group of Formula 2A:  (R 24 O) q (R 25 ) r Si—R 29 —S—Si?R 26 R 27 R 28 ??Formula 2A; (ib3) a group of Formula 2B:  (R 24 O) q (R 25 ) r Si—R 29 —S—H??Formula 2B (ib4) is a group of Formula 2C:  (R 30 O) s (R 31 ) t Si—R 35 —N(H) u (Si?R 32 R 33 R 34 ) v ??Formula 2C, (iib1) is a tertiary amine group of Formula 3A:  wherein,  Si and Si? are each silicon atoms; S is a sulfur atom; O is an oxygen atom; R? is selected from the group consisting of alkyl, aryl and aralkyl; R 13 , R 14  are the same or different and are each independently hydrogen or alkyl; R 15 , R 16  and R 17  are the same or different and each independently selected from the group consisting of hydrogen, alkyl, aryl and aralkyl; R 24  is hydrogen or (C 1 -C 6 ) alkyl; R 25 , R 26 , R 27  and R 28  are each independently selected from the group consisting of hydrogen, (C 1 -C 18 ) alkyl, (C 1 -C 18 ) alkoxy, (C 6 -C 18 ) aryl, and (C 7 -C 18 ) aralkyl; R 29  is a divalent group selected from the group consisting of di-(C 2 -C 20 ) alkylether (alkyl-O-alkyl), a (C 6 -C 18 ) aryl, a (C 7 -C 18 ) alkylaryl, and a (C 1 -C 18 ) alkyl;  where R 29  may be substituted with a substituent selected from the group consisting of a (C 1 -C 4 ) alkyl, a (C 1 -C 4 ) alkoxy, a (C 7 -C 16 ) aryl, a (C 7 -C 16 ) aralkyl, a nitrile, an amine, —NO 2 , and a thioalkyl; R 30  is hydrogen or (C 1 -C 6 ) alkyl; R 31 , R 32 , R 33  and R 34  are each independently selected from the group consisting of hydrogen, (C 1 -C 18 ) alkyl, (C 1 -C 18 ) alkoxy, (C 6 -C 18 ) aryl, and (C 7 -C 18 ) aralkyl; R 35  is a divalent group selected from the group consisting of a di-(C 2 -C 20 ) alkylether (alkyl-O-alkyl), an (C 6 -C 18 ) aryl, a (C 7 -C 18 ) alkylaryl, and a (C 1 -C 18 ) alkyl;  where R 35  may be substituted with a substituent selected from the group consisting of a (C 1 -C 4 ) alkyl, a (C 1 -C 4 ) alkoxy, a (C 7 -C 16 ) aryl, a (C 7 -C 16 ) aralkyl, a nitrile, an amine, —NO 2 , and a thioalkyl; q is the number 0 or 1; r is the number 0 or 1; q+r is 0 or 1; s is the number 0 or 1; t is the number 0 or 1; s+t is the number 0 or 1; u is the number 0, 1 or 2; v is the number 0, 1 or 2; u+v is 2; w is the number 0 or 1; x is the number 0 or 1; w+x=1; and the remaining free valences of the four valent silicon atom are each linked to an alpha-modified polymer macromolecule. | 14. A method for making a modified polymer, comprising:  A) reacting an amine polymerization initiator with a monomer in a polymerization solvent to form Composition A; where the amine polymerization initiator is selected from the group consisting of:  where  M is lithium, sodium or potassium; N is a nitrogen atom; C is carbon atom; H is a hydrogen atom; E is selected from the group consisting of (C 1 -C 18 ) alkylene which is substituted with an amine group which is a tertiary amine, (C 7 -C 18 ) aralkylene, an oxygen atom (O), a sulfur atom (S), N—CHR 8 —CR 9 ?C(M)R 10 , N—CHR 8 —C(M)?CHR 10 , N—C(M)R 8 —CR 9 ?CHR 10 , and N—CHR 8 —CR 9 ?CHR 10 ; R 6  is (C 1 -C 18 ) alkyl; R 7  is selected from the group consisting of hydrogen, (C 1 -C 18 ) alkyl, (C 6 -C 18 ) aryl, (C 7 -C 18 ) aralkyl, —CHR 8 —CR 9 ?CHR 10 , and —SiR 36 R 37 R 38 ;  where R 36 , R 37  and R 38  are each independently selected from the group consisting of (C 1 -C 18 ) alkyl, (C 6 -C 18 ) aryl, and (C 7 -C 18 ) aralkyl; R 8 , R 9 , R 10 , R 11  and R 12 are each independently selected from the group consisting of (C 1 -C 18 ) alkyl, (C 6 -C 18 ) aryl, and (C 7 -C 18 ) aralkyl; a is the number 2; and b is the number zero; and  the monomer is selected from the group consisting of butadiene, styrene, isoprene, and combinations thereof;  B) reacting Composition A with at least one coupling agent selected from the group consisting of SnCl 4 , (R 1 ) 3 SnCl, (R 1 ) 2 SnCl 2 , R 1 SnCl 3 , SiCl 4 , (R 1 ) 3 SiCl, (R 1 ) 2 SiCl 2 , R 1 SiCl 3 , Cl 3 Si—SiCl 3 , Cl 3 Si—O—SiCl 3 , Cl 3 Sn—SnCl 3 , Cl 3 Sn—O—SnCl 3 , Sn(OMe) 4 , Si(OMe) 4 , Sn(OEt) 4 , Si(OEt) 4 , (R 24 O) q (R 25 ) r Si—R 29 —S—Si?R 26 R 27 R 28  (Formula 2A), (R 30 O) s (R 31 ) t Si—R 35 —N(H) u (Si?R 32 R 33 R 34 ) v  (Formula 2C), and combinations thereof, to form Composition B,  where R 1  is a hydrocarbyl group; Si and Si? are silicon atoms; S is a sulfur atom; N is a nitrogen atom; O is an oxygen atom; H is a hydrogen atom; R 24  and R 30  are each independently hydrogen (H), or (C 1 -C 6 ) alkyl; R 25 , R 26 , R 27 , R 28 , R 31 , R 32 , R 33  and R 34  are the same or different, and are each independently selected from the group consisting of: hydrogen (H), (C 1 -C 18 ) alkyl, (C 1 -C 18 ) alkoxy, (C 6 -C 18 ) aryl, and (C 7 -C 18 ) aralkyl; R 29  and R 35  are each divalent groups selected from the group consisting of a di-(C 2 -C 20 )alkylether (alkyl-O-alkyl), an (C 6 -C 18 ) aryl, a (C 7 -C 18 ) alkylaryl, and a (C 1 -C 18 ) alkyl; where each R 29  and R 35  group may independently be substituted with at least one substituent selected from the group consisting of (C 1 -C 4 ) alkyl, (C 1 -C 4 ) alkoxy, (C 7 -C 16 ) aryl, (C 7 -C 16 ) aralkyl, amine, and thioalkyl; q and s are independently the number 2 or 3; r and u are independently the number 0 or 1; q+r=3; s+t=3 and u+v=2;  C) reacting Composition B with at least one chain-end modifying agent of Formula 3B to form the modified polymer; where C is a carbon atom; O is an oxygen atom; N is a nitrogen atom; H is a hydrogen atom; R 15 , R 16  and R 17  are the same or different, and are each, independently, hydrogen or hydrocarbyl groups, where the hydrocarbyl group may be each branched, saturated or unsaturated; R? is a hydrocarbyl group, where the hydrocarbyl group may be each branched, saturated or unsaturated. | 15. A composition comprising a modified polymer comprising:  at least one branched modified polymer macromolecule comprising at least one of structures (ib1), (ib2), (ib3), or (ib4); and at least one linear modified polymer macromolecule comprising the structure (iib1); wherein the at least one branched modified polymer macromolecule and the at least one linear modified polymer macromolecule each, independently comprises at least one amine group selected from the group consisting of:  and combinations thereof;  where N is a nitrogen atom; C is carbon atom; H is a hydrogen atom; E is selected from the group consisting of (i) a (C 1 -C 18 ) alkylene which is substituted with an amine group which is a tertiary amine, R 39 R 40 R 41 Si— or R 39 R 40 R 41 Si-amine group, (C 6 -C 18 ) aryl or (C 7 -C 18 )aralkyl; (ii) tertiary amine group; (iii) R 42 R 43 R 44 SiN group; (iv) an oxygen atom (O); (v) a sulfur atom (S); (vi) N—CHR 8 —CR 9 ?CR 10 ; (vii) N—CHR 8 —C?CHR 10 ; (viii) N—CR 8 —CR 9 ?CHR 10 ; (ix) N—CHR 8 —CR 9 ?CHR 10 ; and (x) H—N group, where  R 39 , R 40  and R 41  are each independently selected from the group consisting of (C 1 -C 18 ) alkyl, (C 6 -C 18 ) aryl, and (C 7 -C 18 ) aralkyl; R 42 , R 43  and R 44  are each independently selected from the group consisting of (C 1 -C 18 ) alkyl, (C 6 -C 18 ) aryl, and (C 7 -C 18 ) aralkyl; R 6  is selected from the group consisting of (i) —SiR 36 R 37 R 38 , (ii) (C 1 -C 18 ) alkyl which is substituted with an amine group, R 45 R 46 R 47 Si group, or (R 45 R 46 R 47 Si) 2 N group, (iii) (C 6 -C 18 ) aryl, (iv) (C 7 -C 18 ) aralkyl, and (v) hydrogen,  R 36 , R 37  and R 38  are each independently selected from the group consisting of (C 1 -C 18 ) alkyl, (C 6 -C 18 ) aryl, and (C 7 -C 18 ) aralkyl; R 45 , R 46  and R 47  are each independently selected from the group consisting of (C 1 -C 18 ) alkyl, (C 6 -C 18 ) aryl, and (C 7 -C 18 ) aralkyl; R 7  is selected from the group consisting of hydrogen, —CHR 8 —CR 9 ?CHR 10 , and —SiR 21 R 22 R 23 ;  R 21 , R 22  and R 23  are each independently selected from the group consisting of (C 1 -C 18 ) alkyl, (C 6 -C 18 ) aryl, and (C 7 -C 18 ) aralkyl; R 8 , R 9 , R 10  are each independently selected from the group consisting of hydrogen, (C 1 -C 18 ) alkyl, (C 6 -C 18 ) aryl, and (C 7 -C 18 ) aralkyl; R 11  and R 12  are each at least divalent, and are each independently selected from the group consisting of (C 1 -C 18 ) alkyl, (C 6 -C 18 ) aryl, and (C 7 -C 18 ) aralkyl; a is the number 1; and b is the number 1; and where (ib1) is a four valent silicon or tin atom selected from the group consisting of (R??) t M group, a (R??) t M(X) p  group, and a M(X) z —(O) x -M(X) z  group, wherein  M is a tin or a silicon atom; O is an oxygen atom; X is a halide atom, an alkoxy group or a hydroxyl group (—OH group); R?? is a (C 1 -C 6 )-alkyl group; z is the number 2; x is the number 0 or 1; t is the number 0 or 1; p is the number 1 or 2; and wherein the remaining free valences on M are each linked to an alpha-modified polymer macromolecule; (ib2) is a group of Formula 2A:  (R 24 O) q (R 25 ) r Si—R 29 —S—Si?R 26 R 27 R 28 ??Formula 2A; (ib3) a group of Formula 2B:  (R 24 O) q (R 25 ) r Si—R 29 —S—H??Formula 2B (ib4) is a group of Formula 2C:  (R 30 O) s (R 31 ) t Si—R 35 —N(H) u (Si?R 32 R 33 R 34 ) v ??Formula 2C, (iib1) is a tertiary amine group of Formula 3A:  wherein,  Si and Si? are each silicon atoms; S is a sulfur atom; O is an oxygen atom; R? is selected from the group consisting of alkyl, aryl and aralkyl; R 13 , R 14  are the same or different and are each independently hydrogen or alkyl; R 15 , R 16  and R 17  are the same or different and each independently selected from the group consisting of hydrogen, alkyl, aryl and aralkyl; R 24  is hydrogen or (C 1 -C 6 ) alkyl; R 25 , R 26 , R 27  and R 28  are each independently selected from the group consisting of hydrogen, (C 1 -C 18 ) alkyl, (C 1 -C 18 ) alkoxy, (C 6 -C 18 ) aryl, and (C 7 -C 18 ) aralkyl; R 29  is a divalent group selected from the group consisting of di-(C 2 -C 20 ) alkylether (alkyl-O-alkyl), a (C 6 -C 18 ) aryl, a (C 7 -C 18 ) alkylaryl, and a (C 1 -C 18 ) alkyl;  where R 29  may be substituted with a substituent selected from the group consisting of a (C 1 -C 4 ) alkyl, a (C 1 -C 4 ) alkoxy, a (C 7 -C 16 ) aryl, a (C 7 -C 16 ) aralkyl, a nitrile, an amine, —NO 2 , and a thioalkyl; R 30  is hydrogen or (C 1 -C 6 ) alkyl; R 31 , R 32 , R 33  and R 34  are each independently selected from the group consisting of hydrogen, (C 1 -C 18 ) alkyl, (C 1 -C 18 ) alkoxy, (C 6 -C 18 ) aryl, and (C 7 -C 18 ) aralkyl; R 35  is a divalent group selected from the group consisting of a di-(C 2 -C 20 ) alkylether (alkyl-O-alkyl), an (C 6 -C 18 ) aryl, a (C 7 -C 18 ) alkylaryl, and a (C 1 -C 18 ) alkyl;  where R 35  may be substituted with a substituent selected from the group consisting of a (C 1 -C 4 ) alkyl, a (C 1 -C 4 ) alkoxy, a (C 7 -C 16 ) aryl, a (C 7 -C 16 ) aralkyl, a nitrile, an amine, —NO 2 , and a thioalkyl; q is the number 0 or 1; r is the number 0 or 1; q+r is 0 or 1; s is the number 0 or 1; t is the number 0 or 1; s+t is the number 0 or 1; u is the number 0, 1 or 2; v is the number 0, 1 or 2; u+v is 2; w is the number 0 or 1; x is the number 0 or 1; w+x=1; and  the remaining free valences of the four valent silicon atom are each linked to an alpha-modified polymer macromolecule.    1
1. A method of selecting a candidate compound for use in the treatment of Alzheimer's disease in a human patient, which method comprises:  (a) incubating proliferating lymphocytes of said patient in the presence of one or more pharmaceutical agent(s), wherein said proliferating lymphocytes exhibit a cell cycle regulatory defect at the G1/S phase transition and wherein said pharmaceutical agent(s) are: i) inhibitors of cell cycle re-entry or progression to the G1/S transition; or ii) inhibitors of progression of the cell cycle through the G1/S transition point; and (b) screening and selecting a compound that corrects said regulatory defect at the G1/S transition in said proliferating lymphocytes as a candidate compound for use in the treatment of Alzheimer's disease in said patient.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             1
Name: Independent Claims, Length: 2784, dtype: int64


Description
CROSS-REFERENCE TO RELATED APPLICATIONS \n\nThis application is a continuation of U.S. application Ser. No. 12/567,718, entitled “Steam Appliance”, filed Sep. 25, 2009, which is herein incorporated by reference in its entirety. \n\nBRIEF DESCRIPTION OF THE DRAWINGS \n\nThe accompanying drawings are not intended to be drawn to scale. For purposes of clarity, not every component may be labeled in every drawing. In the drawings: \n\nFIG. 1  is a side view of a steam appliance system according to one embodiment of the invention;\n\nFIG. 2  is a side view of a first portion of a connector according to one embodiment of the invention;\n\nFIG. 3  is a cross-sectional view of a second portion of a connector configured to engage with the first portion illustrated in FIG. 2; and\n\nFIG. 4  is an exploded perspective view of components of the second connector portion illustrated in FIG. 3.\n\nFIELD OF THE INVENTION \n\nThe invention relates generally to steam appliances, and more specifically to a steam applicator that is connectable to a conduit but constructed and arranged be rotated without loosening or disengaging the connection. \n\nDISCUSSION OF THE RELATED ART \n\nSteam appliances are used in the home to apply steam to floors for cleaning and sanitizing. Various types of steam appliances are known, including canister steam appliances and self-contained steam mops for example. Canister steam appliances typically include a rollable steam generation unit, a hose to transfer the steam from the steam generation unit, a pole, and a mop head or other accessory which is connected to the end of the pole. Self-contained steam mops include a steam generation unit mounted directly on the pole. Handheld steam appliances typically include a container and a nozzle for discharging steam directly from the mouth of the container. \n\nSUMMARY \n\nEmbodiments of the invention provided herein are directed to steam appliances in which a steam applicator is connectable to the steam appliance, but the steam applicator is permitted to rotate without loosening or disengaging the connection of the steam applicator to the steam appliance. \n\nAccording to one embodiment of the invention, a steam appliance includes a steam generation unit, a steam applicator, and a steam conduit configured to guide steam from the steam generation unit to a steam inlet for the steam applicator. The steam applicator is connectable to the steam conduit, and the steam applicator is rotatable relative to the steam conduit in either rotational direction without loosening the connection of the steam applicator to the steam conduit. \n\nAccording to another embodiment of the invention, a method of using a steam applicator having a handle with a end-to-end direction includes acts of grasping the handle with a first hand, grasping a steam conduit with a second hand, bringing a first threaded portion of the steam applicator into contact with a second threaded portion of the steam conduit, and connecting the steam applicator to the steam conduit. The method further includes using the steam applicator to apply steam to an object, and rotating the handle in either rotational direction about the end-to-end direction of the handle to rotate the steam applicator, wherein the rotation of the handle does not loosen the connection of the steam applicator to the steam conduit. Also included is a method of disconnecting the steam applicator from the steam conduit by simultaneously rotating the first threaded portion relative to the second threaded portion and applying an axial force between the conduit and the steam applicator, the axial force being sufficient to overcome a force applied by a resilient element, such that at least one of the first and second threaded portions is altered from a configuration in which the at least one threaded portion is rotatable relative to whichever of the steam applicator and the steam conduit that it is positioned on, to a configuration in which the at least one threaded portion is not rotatable relative to whichever of the steam applicator and the steam conduit that it is positioned on. \n\nAccording to a further embodiment of the invention, a steam appliance includes a steam generation unit, a steam applicator having a handle, a steam conduit to guide steam from the steam generation unit to the steam applicator, and means for mechanically connecting the steam conduit to the handle of the steam applicator. The handle is permitted to repeatedly rotate relative to the steam conduit in either rotation direction about an end-to-end direction of the handle without loosening the connection of the handle to the steam conduit. \n\nVarious embodiments of the present invention provide certain advantages. Not all embodiments of the invention share the same advantages and those that do may not share them under all circumstances. \n\nFurther features and advantages of the present invention, as well as the structure of various embodiments of the present invention are described in detail below with reference to the accompanying drawings. \n\nDETAILED DESCRIPTION \n\nApplicants have recognized the importance of providing a steam applicator assembly which can be freely rotated without compromising the connection of the applicator assembly to a steam conduit. The ability to rotate the steam applicator can be particularly important when the steam applicator assembly is a handheld assembly that is attached to a flexible hose or other flexible conduit because a user may wish to rotate the steam applicator without twisting or kinking the hose. It is also desirable to prevent unintentional disengagement of the steam applicator during rotation of the steam applicator to avoid steam loss and the inconvenience of reconnecting the steam applicator. \n\nAccording to some embodiments of the invention, a steam appliance permits a user to engage and disengage the steam applicator with the same type of motion and without detaching any components. In some embodiments, disconnecting the steam applicator requires two distinct motions. For example, a user may need to push the steam applicator toward the steam conduit and then twist the conduit to separate the steam conduit and the steam applicator. \n\nAccording to one embodiment of the invention, a steam applicator is connected to a flexible steam conduit with a threaded connector configuration which allows rotation of the steam applicator relative to the steam conduit during use without compromising the connection. The threaded connector includes an external thread portion and an internal thread portion. One of the thread portions, for example the internal thread portion, is positioned within an element such as a handle on the steam applicator. The internal thread portion is constructed and arranged to rotate within the handle. By allowing the internal thread portion to “float” within the handle, friction between the thread portions rotates the internal thread portion within the handle, thereby substantially preventing the complementary external thread portion from being fully twisted into or out of the internal thread portion. To successfully twist the external thread portion into or out of the internal thread portion, the user pushes the two thread portions toward each other, which temporarily fixes the internal thread portion to the handle, thereby permitting relative rotation of the two thread portions. \n\nA steam appliance system  100 including two attachable steam applicators 102, 104 is shown in FIG. 1. Steam applicators 102, 104 each may include a handle 107 which is permanently or detachably attached to the applicator. In the embodiment of FIG. 1, steam appliance system 100 includes a steam generation unit 108, a steam conduit 110, and attached steam applicator 102. Steam generation unit 108 may include any suitable type of steam generation system, for example a cool water reservoir 112 and an aluminum die-cast steam generator (not shown). In some embodiments, water may be heated to its boiling point within its reservoir to create steam. It should be noted that the method of steam generation is not intended to be a limiting aspect of the invention.\n\nIn some embodiments, the steam generation unit  108 is handheld, while in other embodiments the steam generation unit may include a shoulder strap, or include wheels or other rollers.\n\nSteam conduit  110 is a flexible hose in some embodiments. Steam conduit 110 may be attachable to steam generation unit 108 with any suitable attachment 114, including a removable connector, such as a bayonet connector.\n\nOne particular embodiment of a steam appliance which permits rotation a steam applicator without compromising the connection of the steam applicator to the steam appliance is shown in  FIGS. 2-4. In this embodiment, a steam appliance includes an externally-threaded connector portion 202 attached to steam conduit 110. A hand grasp portion 206 is attached to steam conduit 110 and threaded connector portion 202 for the user to grip when attaching or detaching steam conduit 110 and handle 107.\n\nSteam conduit includes an elongated stem  208 to guide steam through handle 107 and to a steam outlet 212. O-rings 210 or other seal elements may be positioned on stem 208 to establish a seal with the steam applicator, whether that seal be within the handle of the steam applicator, or within the steam applicator itself. The stem and sealing aspects of the illustrated embodiment are not intended to be limiting. A stress release sleeve 214 may be included at the junction of steam conduit 110 and hand grasp portion 206 in some embodiments.\n\nAn internally-threaded connector portion  302 with threads 304 is positioned within handle 107 in the embodiment illustrated in FIG. 3. Connector portion 302 is permitted to rotate within handle 107, and is also permitted to move axially between stops 306 and 308. Connector portion 302 is biased away from a lock element 310 by a coil spring 312. Instead of a spring, any suitable resilient element may be used to bias connector portion 302 away from lock element 310. For example, a compressible resilient foam gasket may be used in some embodiments. In still other embodiments, a constant force spring, an elastic band, or any other suitable tensioning device, may bias connector portion 302 away from locking element 310 by pulling on connector portion 302.\n\nWhen a user initially inserts externally-threaded connector portion  202 into internally-threaded connector portion 302, rotating the two portions relative to each other will not result in a mating of the threaded portions because connector portion 302 rotates with connector portion 202. However, when the user pushes connector portion 302 against locking element 310 by providing an axial force of at least a threshold force ƒt to overcome the force provided by coil spring 312 connector portion is prevented from rotating by more than a small angle because locking tabs 314 on connector portion 302 are rotated into abutment with locking tabs 316 on the locking element 310. With locking element 310 prevented from rotating, connector portion 202 can be twisted into mating engagement with connector portion 302. Locking element 310 is prevented from moving axially away from connector portion 302 by a stop 318.\n\nIn this manner, two distinct motions are required of the user to attach or remove a steam applicator from steam conduit  110. While in the illustrated embodiment the two distinct motions include an axial force and a twisting force acting simultaneously, other multiple distinct action configurations may be used. For example, in some embodiments, a ball and groove quick disconnect coupling is used to connect a steam conduit to a steam applicator. In such an embodiment, a first motion may include moving a locking collar, and a second motion may include pulling the handle of the steam applicator away from the steam conduit. Some embodiments may require two or more distinct motions to remove a steam applicator, while allowing attachment of a steam applicator with only a single motion.\n\nBy requiring two or more distinct motions to remove a steam applicator, unintended disengagement or loosening of the steam applicator during use of the steam appliance may be prevented. For example, the user may rotate the steam applicator in either direction about an end-to-end direction of the steam application when cleaning surfaces, and it may be beneficial to avoid having the steam conduit rotate as a result of the steam applicator rotations. By allowing connector portion  302 to rotate relative to handle 107, handle 107 can rotate without twisting steam conduit 110 and with loosening the engagement of the two threaded connectors. For purposes herein, loosening a connection is intended to include compromising a connection. For example, in some embodiments, a connection may become less than fully engaged such that the connection is at risk of disengaging, yet the connection may not permit perceptible movement of the two connected components relative to one another.\n\nIn some embodiments, one or more rotation stops may be included to limit the rotation angle of the steam applicator in either rotation direction (e.g., clockwise and counterclockwise about an end-to-end direction of the steam applicator). In such an embodiment, the steam applicator is permitted to rotate a certain amount, for example by permitting connector portion  302 to rotate, but the steam applicator rotation is prevented from further rotations by the rotation stops. The rotation stops may include one or more tabs (not shown) protruding from an interior wall of handle 107 between stops 306 and 308. In some embodiments, the steam applicator is permitted to rotate 180 degrees in either direction, and in some embodiments, the steam applicator is permitted to rotate 360 degrees in either direction.\n\nThe embodiments described above allow for a tool-free attachment and removal of steam applicators from the steam appliance. In some embodiments, however, a tool may be used. \n\nWhile embodiments described herein are directed to rotations of a steam applicator or a handle about an end-to-end direction of the steam application or the handle, in some embodiments, pitch and/or yaw rotations may be permitted as well. A universal joint may be used in addition to, or instead of, the structures described herein. \n\nFor purposes herein, the terms “connect”, “connected”, “connection”, “attach”, “attached” and “attachment” refer to direct connections and attachments, indirect connections and attachments, and operative connections and attachments. For example, steam applicator  102 is considered to be connected to steam conduit 110 even though steam applicator is directly connected to handle 107 which is, in turn, connected to steam conduit 110. Also for purposes herein, the terms “connectable”, “attachable”, “removable”, etc. refer both to components which can be connected, attached, removed, etc., and also refer to components which are connected, attached and removed.\n\nFor ease of understanding, and without limiting the scope of the invention, the embodiments to which this disclosure is addressed are described above particularly in connection with a handheld portable steam appliance. It should be appreciated, however, that the present invention can be embodied in other types of steam appliances. Additionally, while the steam applicators described above employ steam pocket technology, other types of steam applicators may be used in conjunction with embodiments disclosed herein. \n\nHaving thus described several aspects of at least one embodiment of this invention, it is to be appreciated various alterations, modifications, and improvements will readily occur to those skilled in the art. Such alterations, modifications, and improvements are intended to be part of this disclosure, and are intended to be within the spirit and scope of the invention. Accordingly, the foregoing description and drawings are by way of example only.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           1
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING \n\nFIG. 1  is a diagram schematically illustrating steps of mounting a semiconductor chip to a printed substrate according to one embodiment of the present invention;\n\nFIG. 2  is a schematic diagram illustrating a part of a printed substrate manufacturing equipment according to one embodiment of the present invention, that is, a part configured to deliver a film to be used as an underfill to a film carrying jig; and\n\nFIG. 3  is a schematic diagram illustrating a part of the printed substrate manufacturing equipment according to one embodiment of the present invention, that is, a part configured to apply the film to be used as the underfill to the printed substrate.\n\nINCORPORATION BY REFERENCE \n\nThe present application claims priority from Japanese Application P2011-067147 filed on Mar. 25, 2011, the content of which is hereby incorporated by reference into this application. \n\nBACKGROUND OF THE INVENTION \n\n1. Field of the Invention \n\nThe present invention relates to printed substrate manufacturing equipment and manufacturing method, and more particularly relates to printed substrate manufacturing equipment and manufacturing method favorably used to mount a semiconductor chip onto a printed substrate. \n\n2. Description of the Related Art \n\nIn flip chip bonding in a printed substrate, a solder ball is adhered to a connection pad which is formed on the printed substrate and a semiconductor chip is mounted on the substrate via the solder ball. When the semiconductor chip is mounted on the printed substrate by the above-mentioned flip chip bonding method, a gap G is formed between the semiconductor chip and the printed substrate in accordance with the height of the solder ball which is adhered to the connection pad. Therefore, such a problem may occur that the supporting force of the semiconductor chip is reduced and hence a crack is generated in a solder ring part of the solder ball. In particular, when the temperature is greatly changed, thermal stress may be exerted on the solder ball and the crack may be generated in the solder ball due to the thermal stress because thermal expansion coefficients of the semiconductor chip and the printed substrate are different from each other. \n\nThus, it has been practiced so far to inject an underfill liquid which is a liquid substance into the gap G generated between the semiconductor chip and the printed substrate by using a dispenser in order to stably support the semiconductor chip as disclosed, for example, in Japanese Patent Application Laid-Open No. 2010-118634. Since the underfill liquid is injected into the gap G, it is desirable to prevent the liquid from leaking to the outside and hence a spill prevention dam is formed on an edge of the board. \n\nIn a printed substrate described in Japanese Patent Application Laid-Open No. 2010-118634, a dispenser is used to form a spill prevention dam. Hitherto, a space between respective bumps has been wide enough to use the dispenser. However, the space between the bumps is reduced as the chip is refined and it becomes difficult to inject the underfill liquid by using the dispenser. Thus, formation of the underfill is difficult, which makes it also difficult to prevent generation of a crack due to thermal stress exerted between the semiconductor chip and the substrate. Thus, a substitutive method for the method of injecting the underfill liquid using the dispenser is searched for. \n\nBRIEF SUMMARY OF THE INVENTION \n\nThe present invention has been made in view of the drawbacks of the above mentioned related art and an object of the present invention is to fix a printed substrate and a semiconductor chip to each other by filling a gap between them so as to obtain the same effect as that obtained when an underfill liquid is used. Another object is to implement a highly accurate printed substrate that prevents generation of a crack. \n\nIn order to solve the above mentioned problems, the present invention provides a printed substrate manufacturing method of forming solder bumps on a plurality of electrode parts of a printed substrate and loading a semiconductor chip on the printed substrate via the plurality of solder bumps, including preparing a thermoplastic film to be used as an underfill that covers a surface of the printed substrate on which the solder bumps are formed, wherein parts of the film corresponding to the solder bumps are removed and a peripheral edge of a part of the film on which the semiconductor chip will be loaded has a protruded form, covering the printed substrate with the film and thereafter applying the film onto the board, loading the semiconductor chip on the printed substrate and carrying the board into a reflow furnace and applying heat and pressure to fuse the solder bumps in the reflow furnace. \n\nIn the above mentioned printed substrate manufacturing method, preferably, in preparing the film, after the film which is in a rolled-up state has been cut into a section of a predetermined size, the film so cut is carried to a film drilling unit using a film carrying jig, drilling is performed on a part of the film corresponding to each solder bump formed on the printed substrate by the film drilling unit, and then the film is inverted together with the film carrying jig. \n\nIn order to solve the above mentioned problems, the present invention also provides a printed substrate manufacturing equipment, including a film supply unit on which a thermoplastic film to be used as an underfill is wound in roll, a film drilling unit for drilling a part of the film supplied from the film supply unit corresponding to the position of a solder bump formed on a printed substrate, a film inversion unit for inverting the film together with a film carrying jig that holds the film and a film bonding unit for bonding the inverted film onto the printed substrate, wherein the film bonding unit includes an upper table for holding the inverted film carrying jig and film, a lower table on which the printed substrate is placed and which includes a heater for heating the printed substrate, and a driving device for vertically moving the upper table and the lower table. \n\nPreferably, the above mentioned printed substrate manufacturing device further includes a reflow furnace into which a semiconductor chip which is loaded on the printed substrate to which the film has been bonded by the film bonding unit is carried to fuse the solder bump to fix the semiconductor chip to the printed substrate. \n\nDETAILED DESCRIPTION OF THE INVENTION \n\nPrinted substrate manufacturing equipment and manufacturing method according to the present invention will be described with reference to the accompanying drawings.  FIG. 1 is a diagram for describing one embodiment of a manufacturing method for a printed substrate 33 according to the present invention, illustrating respective steps of mounting a semiconductor chip 41 to the printed substrate 33. Although not illustrated in FIG. 1, solder bumps 39 are printed on a surface of the printed substrate 33 by using a solder ball printer and reflow soldering is performed to fix the bumps onto the surface of the printed substrate 33 in a pre-process of manufacturing.\n\nAs illustrated in portion (a) of  FIG. 1, the printed substrate 33 with the solder bumps 39 formed is carried into an underfill formation unit and is loaded on a lower table 34 (step S1). When the printed substrate 33 is loaded on the lower table 34, an underfill film (hereinafter, referred to as a film as the case may be) 30 on which drilling is performed in advance by a CVD (Chemical Vapor Deposition) device after the form of each solder bump 39 is supplied from a not-illustrated underfill film supply device.\n\nA protrusion (protruded part)  40 is formed on an end (for example, a peripheral edge) of the film 30. The protrusion 40 is formed so as to prevent the semiconductor chip 41 from moving on the printed substrate 33 regardless of application of vibration or the like to the printed substrate 33, when it is intended to move the semiconductor chip 41 in a state that is loaded on the printed substrate 33.\n\nThe film  30 is 5 to 20 ?m in thickness and thermoplastic. The film 30 is made adhesive with heat to adhere the semiconductor chip 41 to the printed substrate 33. Marks for alignment are made on the film 30 and the printed substrate 33. An underfill film formation unit (for example, a film bonding device) 50 includes an imaging camera (for example, a two-field camera with upper and lower fields) 32 for detecting these marks and takes a picture of the position of each mark by the camera 32. The picture that the camera 32 has taken is sent to a not-illustrated control unit and is subjected to image processing by the control unit. Then, an amount of misalignment between the mark positions is obtained and a lower table 34 is horizontally moved to align the film 30 with the printed substrate 33.\n\nAfter alignment of the film  30 with the printed substrate 33 has been completed as illustrated in portion (b) of FIG. 1, the film 30 is lowered toward the surface of the printed substrate 33. Then, the printed substrate 33 is covered with the film 30 except parts corresponding to the solder bumps 39 (step S2). The semiconductor chip 41 is loaded on the solder bumps 39 after the printed substrate 33 has been covered with the film 30 as illustrated in portion (c) of FIG. 1 (step S3).\n\nPictures of alignment marks on the semiconductor chip  41 and the solder bumps 39 are taken by the camera 32 also when the semiconductor chip 41 is to be aligned with the solder bumps 39. Then, an amount of misalignment between them is measured as in the case in alignment of the film 30 with the printed substrate 33 and a grip of the semiconductor chip 41 is horizontally moved in accordance with the amount of misalignment to align the semiconductor chip 41 with the solder bumps 39. If the printed substrate 33 is moved after the semiconductor chip 41 has been mounted on it, the possibility of occurrence of misalignment will be increased because the semiconductor chip 41 is simply placed on the solder bumps 39. Thus, the protruded part is formed on the end of the film 30 on the side on which the semiconductor chip 41 is to be loaded. As an alternative, the protruded part may be formed when drilling is performed on the film 30.\n\nAfter the semiconductor chip  41 has been mounted on the printed substrate 33 and a mounted state thereof has been inspected, the printed substrate 33 is carried to a reflow furnace. The underfill film 30 is pressed downward in a direction of an arrow in the reflow furnace as illustrated in portion (d) of FIG. 1. Heating is performed simultaneously with pressing. The printed substrate 33 and the semiconductor chip 41 are adhered and fixed to each other by heating and pressing (HP) the film 30 (step S4). After fixing of the semiconductor chip 41 onto the printed substrate 33 has been completed, the printed substrate 33 is carried to a process of inspection.\n\nFIG. 2  illustrates a forming device 45 for the underfill film (film) 30. In an example illustrated in FIG. 2, the film 30 is formed as a sheet-shaped roll. A film roll 11 includes a cover film 12 and the underfill film 30. The cover film 12 and the underfill film 30 are laminated in order from within.\n\nA guide roll  13 is disposed below the film roll 11 in order to carry the film 30 from the film roll 11 onto a carrying surface. The guide roll 13 is used to peel off the cover film 12. The peeled-off cover film 12 is taken up on a take-up roll 14 which is disposed adjacent to the film roll 11. Drive units for the film roll 11 and the take-up roll 14 include a not-illustrated torque adjuster respectively, for adjusting torque in accordance with the residual quantity of the film 30. The torque is adjusted by the torque adjuster, by which it is allowed to carry the film 30 in a state that its tension is maintained constant.\n\nA leading end holding member  15 and a trailing end holding member 16 for carrying the film 30 in a state that predetermined areas of the leading and trailing ends of the film 30 are sucked and adsorbed to them are disposed under the guide roll 13. A vacuum chamber is disposed in the leading end holding member 15 and an adsorption hole is formed in its upper surface. The vacuum chamber is connected to a not-illustrated vacuum pump. When the vacuum pump is driven, the leading end of the film is sucked and adsorbed to the upper surface of the leading end holding member 15. That is, the film 30 is held on the leading end holding member 15 by using a vacuum adsorption mechanism.\n\nThe leading end holding member  15 is supported on a movable part 21 of a ball screw 20 which is disposed under the leading end holding member 15. The ball screw 20 is directly connected to a servo motor 19. The leading end holding member 15 which is supported on the movable part 21 of the ball screw 20 is moved in a lateral direction (a film carrying direction) by driving the servo motor 19. An air cylinder 17 is connected to the movable part 21. The air cylinder 17 is allowed to carry the leading end of the film 30 to a position where the film 30 is adjacent to one of a pair of pressing rollers 23 that configure a pressing unit for pressing the film 30.\n\nA vacuum chamber is disposed in the trailing end holding member  16 and an adsorption hole is formed in its upper surface as in the case of the leading end holding member 15. A groove which extends in a width direction is formed in the member 16. The groove is also used as a cutter pedestal when the film 30 will be cut in the width direction by a cutter mechanism 18. The cutter mechanism 18 is disposed above the trailing end holding member 16 and is configured to be moved in the width direction by a rodless cylinder or the like. The cutter mechanism 18 is used to cut the film 30 in the width direction.\n\nSince the movable part  21 of the ball screw 20 supports the leading end holding member 15, the film 30 is carried with accuracy. In addition, since a coupling member 22 is rotated by driving a rotary actuator disposed on the movable part 21, it is allowed to retreat the trailing end holding member 16 downward from the film carrying surface.\n\nEach pressing roller  23 is configured by covering an outer periphery of a metal roll with highly heat-resistant rubber (silicon rubber or the like) so as to have a thickness of about 1.2 mm. When a voltage is applied to the film 30 from an electrode 26 included in a static electricity generator 28, the pressing roller 23 holds the film 30 on its surface by electrostatic adsorption. Therefore, if the rubber that covers the outer peripheral of the roller 23 is silicon rubber, its electric resistance will be increased. However, since the outer periphery covering rubber has such a thin thickness as about 1.2 mm, its influence on the electrostatic adsorption is little. It goes without saying that the effect of electrostatic adsorption will be increased by using heat-resistant conductive rubber.\n\nThe pair of pressing rollers  23 are vertically disposed so as to pinch a film carrying jig 24 which is carried on a carrier roller 25 from above and from below. A not-illustrated air cylinder is coupled to each of the vertically disposed pair of pressing rollers 23 and the pressing rollers 23 are vertically moved by driving the air cylinder. Here, a metal part of each pressing roller 23 is grounded.\n\nNext, a film bonding operation will be described. In preparation for bonding of the film  30, the film 30 is manually drawn out from the film roll 11 and is delivered to the guide roll 13. The guide roll 13 peels off the cover film 12 as described above. The peeled-off cover film 12 is taken up on the take-up roll 14. The remaining film 30 is drawn out until it reaches the leading end of the trailing end holding member 16 and its rear surface side is sucked and adsorbed to the leading end holding member 15 and the trailing end holding member 16.\n\nIn the above mentioned case, a motor which is the drive unit connected to the film roll  11 and the take-up roll 14 is operated to exert a constant tension on the film 30. In the above-mentioned state, the groove part in the trailing end holding member 16 is positioned such that a cutting blade of the cutter mechanism 18 passes along it. Then, the cutter mechanism 18 is moved in the width direction to cut the film 30. When cutting of the film 30 has been completed, sucking and adsorbing force of the trailing end holding member 16 that has adsorbed the film 30 so far is released and a cut-off piece of the film 30 is discarded. In the above-mentioned case, the film 30 is sucked and adsorbed to the leading end holding member 15 in a state that the leading end of the film 30 is protruded beyond the leading end of the leading end holding member 15 by about 10 mm, by which preparation for the operation of bonding the film 30 is completed.\n\nIn a state that preparation for application of the film  30 has been completed, both the pressing rollers 23 which are positioned on and under the substrate carrying surface are at upper positions and are rotating in a substrate carrying direction in a state that the rollers 23 are heated by built-in heaters. An upper surface of the lower pressing roller 23 is in contact with the film carrying jig 24 to carry the film carrying jig 24 from the left side toward the right side in an example illustrated in FIG. 2.\n\nIn the operation of bonding the film  30, first, the servo motor 19 is operated to move the movable part 21 of the ball screw 20 to the neighbourhood of the pressing rollers 23. When a rotary actuator disposed on the trailing end holding member 16 is driven, the coupling member 22 rotates to retreat the trailing end holding member 16 downward from the film carrying surface.\n\nNext, the air cylinder  17 is operated to move the leading end holding member 15 until the leading end of the film 30 reaches a position around the center of the upper surface of the upper pressing roller 23. After the film 30 has been situated at the above-mentioned predetermined position, a high voltage is applied from a not-illustrated static electricity generation source to the electrode 26. In the above mentioned case, the leading end of the film 30 is situated between the electrode 26 and the upper pressing roller 23. Thus, a film leading end part which is protruded beyond the leading end holding member 15 is charged and adsorbed to the grounded upper pressing roller 23.\n\nThe upper pressing roller  23 is rotated in a carrying direction of the film carrying jig 24 and carries the adsorbed film 30 downward (toward the film carrying jig 24). When sucking and adsorbing force of the leading end holding member 15 is released, the film 30 is carried toward the printed substrate 33 with rotation of the upper pressing roller 23. Then, the air cylinder 17 and the movable part 21 are operated to return the leading end holding member 15 that has delivered the film 30 to the pressing roller 23 to a position under the guide roll 13. At the same time, the rotary actuator is driven to rotate the coupling member 22 so as to also return the retreated trailing end holding member 16 to the position of the film carrying surface.\n\nAfter the film  30 has been carried to a position (where the film 30 is brought into contact with the surface of the carried film carrying jig 24) directly under the upper pressing roller 23, rotation of the pressing rollers 23 is stopped. Then, the film 30 which is positioned above the leading end holding member 15 and the trailing end holding member 16 is held in a state that it is sucked and adsorbed to the respective holding members 15 and 16 at its leading and trailing ends. The cutter mechanism 18 is driven to cut the film 30 in the width direction. In the above-mentioned case, positions of the cutter mechanism 18 and the trailing end holding member 16 are adjusted such that the cut film 30 has a length which is long enough to be bonded to the printed substrate 33.\n\nAs an alternative, the cutter mechanism  18, the leading end holding member 15 and the trailing end holding member 16 may be operated in synchronization with carrying of the film 30 without stopping the rotation of the pressing rollers 23 so as to cut the film 30 in an adsorptive-held state. The film carrying jig 24 is formed longer than the printed substrate 33 to which the film 30 will be actually bonded.\n\nAfter the film  30 has been cut to a predetermined length, the carrier roller 25 carries the film carrying jig 24 to a film bonding position (where the film will be bonded to the substrate). After the film carrying jig 24 has reached the film bonding position, a heightwise position of the lower pressing roller 23 is left as it is and only the upper pressing roller 23 is lowered (toward the lower pressing roller 23). As a result, the film 30 comes into contact with the surface of the film carrying jig 24 and then pressing is started. In the above-mentioned process, the film 30 is carried to the pressing rollers 23 simultaneously with carrying of the film carrying jig 24. However, since the trailing end holding member 16 is also moved toward the pressing rollers 23 in synchronization with carrying of the film 30, the tension exerted on the film is made constant.\n\nThe film  30 is gradually pressed onto the film carrying jig 24 with rotation of the pressing rollers 23. On the other hand, when the trailing end holding member 16 to which the film 30 is adsorbed reaches the vicinity of the pressing rollers 23, a high voltage is applied to the electrode 26 of the static electricity generator 28 as in the case that the leading end of the film 30 is delivered from the leading end holding member 15 to the pressing roller 23. When the high voltage is applied to the electrode 26, the trailing end of the film 30 which is situated under the electrode 26 is charged and electrostatically adsorbed to the pressing roller 23.\n\nAfter the trailing end of the film  30 has been wholly delivered to the pressing roller 23, the sucking and adsorbing force of the trailing end holding member 16 is released. Then, the coupling member 22 is rotated to retreat the member 16 downward. On the other hand, the leading end holding member 15 is in a state that the leading end of a film 30 to be bonded next is sucked and adsorbed to it and is moved to the vicinity of the pressing roller 23 in a state that the film 30 is stuck and adsorbed to it.\n\nSince the trailing end of the film  30 is electrostatically adsorbed to the pressing roller 23, close contact of the film 30 with the film carrying jig 24 is allowed without letting the film 30 hang down from the surface of the film carrying jig 24. Thus, a film-bonding part may not be crumpled and any bubble may not enter it in pressing. Since the lower pressing roller 23 is grounded, the static electricity of the film 30 which is held on the upper pressing roller 23 is discharged when the film 30 comes into contact with the film carrying jig 24.\n\nAfter the entire surface of the film  30 has been pressed onto the surface of the film carrying jig 24, the upper pressing roller 23 is moved upward to deliver the next film 30 from the leading end holding member 15 to the upper pressing roller 23. After the leading end of the film 30 has been delivered to the upper pressing roller 23, the leading end holding member 15 moves to a position under the guide roll 13. At the same time, the trailing end holding member 16 which is in a retreated state is also returned to the position of the film carrying surface. As a result, a series of processes of the film bonding operation is completed.\n\nIn the above mentioned embodiment, the leading and trailing ends of the film  30 are electrostatically adsorbed to the holding members 15 and 16 in order to deliver the film 30 to the pressing roller 23. As an alternative, the entire surface of the film 30 may be electrostatically charged to be adsorbed to the pressing roller 23. In addition, as a substitution for the vacuum adsorption mechanism which is used as the film holding mechanism included within the leading end holding member 15 and the trailing end holding member 16, an electrostatic adsorption holding mechanism may be used as in the case of the unit for making the film 30 adsorb to the pressing roller 23.\n\nThe film  30 which is attached onto the film carrying jig 24 is sent to a not-illustrated drilling unit in which, then, drilling is performed on a part corresponding to the electrode part (the part corresponding to the part of forming the solder bump 39) on the printed substrate 33. Drilling is performed by a not-illustrated drilling machine. Before performing drilling, a protrusion is formed on an end of the film 30 by using a press machine. Owing to formation of the protrusion, the semiconductor chip 41 may not be moved with vibration or the like when the printed substrate 33 is to be moved simply by placing the semiconductor chip 41 on the printed substrate 30 without fixing it to the substrate. As an alternative, the protrusion may be formed when the film 30 is bonded onto the printed substrate 33.\n\nThe drilled film  30 is carried to the film bonding device 50 in order to load the drilled film 30 on the printed substrate 33. FIG. 3 illustrates a schematic configuration of the film bonding device 50. In the film bonding device 50, the lower table 34 on which the printed substrate 33 will be loaded is disposed on a base 31.\n\nThe lower table  34 includes a not-illustrated XY? table for moving the lower table 34 in a horizontal plane and an XY? table driving mechanism 36. Supports are disposed on four corners of the base 31 and an upper table support beam 37 for holding an upper table 35 is attached onto the supports. A driving device 38 for vertically moving the upper table 35 is disposed on the support beam 37. The upper table 35 is attached to the driving device 38. The two-field camera 32 with upper and lower fields is disposed between the upper table 35 and the lower table 34 to be horizontally movable.\n\nBefore the film carrying jig  24 with the film 30 attached is carried into the film bonding device 50, a surface of the film 30 to be held is inverted together with the film carrying jig 24 by a not-illustrated inverting device. The film carrying jig 24 is carried into the film bonding device 50 in an inverted state. Then, the film carrying jig 24 is held under the upper table 35 which is disposed in opposition to the lower table 34 on which the printed substrate 33 is loaded with the film surface turned downward. In the above mentioned case, a negative pressure is applied to a not-illustrated surface of the upper table 35 to hold the film 30 under the upper table 35 by vacuum adsorption together with the film carrying jig 24.\n\nPictures of alignment marks which are formed in advance on the surface of the film  30 and the surface of the printed substrate 33 are taken by the two-field camera 32 with upper and lower fields. A not-illustrated control unit performs image processing on the taken pictures to obtain an amount of misalignment between the alignment marks on the surfaces of the film 30 and the substrate 33. The lower table 34 is horizontally moved for alignment on the basis of the obtained misalignment amount. Since the lower table 34 includes a heater, it is allowed to heat the printed substrate 33 to a predetermined temperature. When the printed substrate 33 is loaded on the lower table 34, the heater is turned on to warm the printed substrate 33. After the pictures of the alignment marks have been taken, the two-field camera 32 with upper and lower fields is retreated from surfaces of the upper table 35 and lower table 34.\n\nAt the completion of alignment, the table vertically driving mechanism  38 is operated to lower the upper table 35 with the film 30 supported. The film 30 is bonded onto the surface of the printed substrate 33 while applying a predetermined pressure onto the surface of the printed substrate 33. That is, heat and pressure are applied to temporarily fix the underfill film (film) 30 onto the surface of the printed substrate 33 except the electrode part of the printed substrate 33. In the above mentioned description, a process of forming the protrusion 40 on the end (the part corresponding to an end (for example, a peripheral edge) of the semiconductor chip) is performed before the process of drilling the film 30 is performed. As an alternative, the protrusion to which the end of the semiconductor chip 41 is fixed may be formed when performing the process of bonding the film 30 onto the printed substrate 33.\n\nAt the completion of bonding of the film  30, the flow proceeds to a process of mounting the semiconductor chip 41 on the printed substrate 33. In mounting the semiconductor chip 41 on the printed substrate 33, the position of the electrode of the semiconductor chip 41 is measured in advance by using the camera 32. The semiconductor chip 41 is mounted on the surface of the printed substrate 33 with the underfill film 30 formed by using an existing chip mounter with robot hand.\n\nThe printed substrate  33 with the semiconductor chip 42 mounted is carried into the reflow furnace in which, then, a soldering chip is fused to fixedly bond the semiconductor chip 42 to the printed substrate 33. Since the semiconductor chip 41 is not fixed to the printed substrate in carrying the substrate 33 into the reflow furnace, the protrusion 40 is formed on the end of the underfill film 30 to hold the end of the semiconductor chip 41 so as to avoid movement of the semiconductor chip 41.\n\nIn the above mentioned embodiment, before the semiconductor chip is pressed onto the printed substrate, the underfill film is formed after the form of the printed substrate from which the electrode part is eliminated and the underfill film so formed is bonded onto the surface of the printed substrate to mount the semiconductor chip in a predetermined position, in place of an existing method of mounting a semiconductor chip on a printed substrate and then injecting an underfill liquid into between the printed substrate and the semiconductor chip. Owing to the above mentioned arrangement, it may become possible to cope with a reduction in space between electrodes which is caused by refinement. That is, it may become possible to firmly fix the semiconductor chip to the printed substrate regardless of presence of such a narrow space between the printed substrate and the semiconductor chip that a capillary phenomenon which is utilized when a liquefied underfill is used may not occur. \n\nAccording to the present invention, since the underfill is formed by a plastic film, it may become possible to fix the substrate and the semiconductor chip to each other so as to obtain the same effect as that obtained when an underfill liquid is used. In addition, since it may become possible to surely fix the semiconductor chip and the printed substrate to each other with the underfill film, it may become possible to avoid generation of a crack due to thermal stress or the like.                                                                                                                                                                                                                                                                                                                                                                                               1
CROSS-REFERENCE TO RELATED APPLICATIONS \n\nThis application is a continuation of U.S. patent application Ser. No. 13/222,929, filed Aug. 31, 2011, (now granted as U.S. Pat. No. 8,512,657), which is a continuation-in-part of U.S. patent application Ser. No. 12/712,681, filed on Feb. 25, 2010, (now granted as U.S. Pat. No. 8,012,439), which claims priority to GB Patent Application Nos. 0903262.4, filed on Feb. 26, 2009, and 0922612.7, filed on Dec. 24, 2009, and this application is a continuation-in-part of U.S. patent application Ser. No. 13/203,631, filed on Aug. 26, 2011, (now granted as U.S. Pat. No. 8,608,820), as the national stage application of International Application No. PCT/GB2010/050347, filed on Feb. 26, 2010, which claims priority to GB Patent Application Nos. 0903262.4, filed on Feb. 26, 2009, and 0922612.7, filed on Dec. 24, 2009, all of which are incorporated herein by reference in their entireties. \n\nBRIEF DESCRIPTION OF THE DRAWINGS \n\nIn order that the invention may be more fully understood, reference is made to the accompanying drawings wherein: \n\nFIG. 1  is a graph showing the size distributions of PM in the exhaust gas of a diesel engine. For comparison, a gasoline size distribution is shown at FIG. 4 of SAE 1999-01-3530;\n\nFIGS. 2A-C  show schematic drawings of three embodiments of washcoated porous filter substrates according to the invention;\n\nFIG. 3  is a schematic graph of mercury porosimetry relating the pore size distribution of a porous filter substrate, a porous washcoat layer and a porous filter substrate including a porous surface washcoat layer;\n\nFIG. 4  is a Table setting out a matrix of wallflow filter substrate pore size vs. washcoat loading indicating the suitability of the coated wallflow filter for use in a vehicular gasoline exhaust gas aftertreatment system;\n\nFIG. 5  is a graph showing the results of a Soot Loading Back Pressure study comparing backpressure against soot loading for 5.66 inch×6 inch SiC wallflow filters coated with two different oxidation catalyst washcoat loadings (g/in3) and a bare filter (all not according to the invention) with a Fe/beta zeolite selective catalytic reduction (SCR) catalyst (according to the invention) at a comparable washcoat loading;\n\nFIG. 6  is a graph comparing the backpressure in the same Soot Loading Back Pressure test for a Cu/SSZ-13 zeolite (a small pore zeolite) catalyst and a Fe/Beta zeolite (a large pore zeolite) SCR catalyst; and\n\nFIG. 7  is a bar chart comparing the particulate number emissions (particulate number per kilometer) from a 2.0 liter Euro 5 compliant light duty diesel vehicle fitted with standard diesel oxidation catalyst followed by a 3.0 liter SiC filter at 23 ?m nominal mean pore size coated with a Fe/Beta zeolite SCR catalyst for meeting the Euro 5/6 particle number emission limit of 6×1011 km?1 (UN/ECE Particulate Measurement Programme (PMP)) with the same system containing a bare filter.\n\nFIELD OF THE INVENTION \n\nThe present invention relates to a filter for use in treating particulate matter (PM) in exhaust gas derived from any combustion process, such as from a compression ignition engine or from a positive ignition engine. In an embodiment, the filter is used to treat PM in exhaust gas derived from any combustion process where it is not possible to remove PM from the exhaust gas by build-up of PM (so-called “cake filtration”) or by a combination of depth filtration and cake filtration. The combustion process is typically that of a vehicular engine. In particular, an embodiment of the invention relates to a filter for use in treating PM derived from a vehicular positive ignition engine, particularly stoichiometrically operated positive ignition engines but also lean-burn positive ignition engines. Another embodiment of the invention relates to a filter for use in treating PM and oxides of nitrogen derived from a compression ignition engine. \n\nBACKGROUND OF THE INVENTION \n\nPositive ignition engines cause combustion of a hydrocarbon and air mixture using spark ignition. Contrastingly, compression ignition engines cause combustion of a hydrocarbon by injecting the hydrocarbon into compressed air and can be fuelled by diesel fuel, biodiesel fuel, blends of diesel and biodiesel fuels and compressed natural gas. Positive ignition engines can be fuelled by gasoline fuel, gasoline fuel blended with oxygenates including methanol and/or ethanol, liquid petroleum gas or compressed natural gas. \n\nAmbient PM is divided by most authors into the following categories based on their aerodynamic diameter (the aerodynamic diameter is defined as the diameter of a 1 g/cm 3 density sphere of the same settling velocity in air as the measured particle):\n\n(i) PM-10—particles of an aerodynamic diameter of less than 10 ?m; \n\n(ii) Fine particles of diameters below 2.5 ?m (PM-2.5); \n\n(iii) Ultrafine particles of diameters below 0.1 ?m (or 100 nm); and \n\n(iv) Nanoparticles, characterised by diameters of less than 50 nm. \n\nSince the mid-1990's, particle size distributions of particulates exhausted from internal combustion engines have received increasing attention due to possible adverse health effects of fine and ultrafine particles. Concentrations of PM-10 particulates in ambient air are regulated by law in the USA. A new, additional ambient air quality standard for PM-2.5 was introduced in the USA in 1997 as a result of health studies that indicated a strong correlation between human mortality and the concentration of fine particles below 2.5 ?m. \n\nInterest has now shifted towards nanoparticles generated by diesel and gasoline engines because they are understood to penetrate more deeply into human lungs than particulates of greater size and consequently they are believed to be more harmful than larger particles, extrapolated from the findings of studies into particulates in the 2.5-10.0 ?m range. \n\nSize distributions of diesel particulates have a well-established bimodal character that correspond to the particle nucleation and agglomeration mechanisms, with the corresponding particle types referred to as the nuclei mode and the accumulation mode respectively (see  FIG. 1). As can be seen from FIG. 1, in the nuclei mode, diesel PM is composed of numerous small particles holding very little mass. Nearly all diesel particulates have sizes of significantly less than 1 ?m, i.e. they comprise a mixture of fine, i.e. falling under the 1997 US law, ultrafine and nanoparticles.\n\nNuclei mode particles are believed to be composed mostly of volatile condensates (hydrocarbons, sulfuric acid, nitric acid etc.) and contain little solid material, such as ash and carbon. Accumulation mode particles are understood to comprise solids (carbon, metallic ash etc.) intermixed with condensates and adsorbed material (heavy hydrocarbons, sulfur species, nitrogen oxide derivatives etc.) Coarse mode particles are not believed to be generated in the diesel combustion process and may be formed through mechanisms such as deposition and subsequent re-entrainment of particulate material from the walls of an engine cylinder, exhaust system, or the particulate sampling system. The relationship between these modes is shown in  FIG. 1.\n\nThe composition of nucleating particles may change with engine operating conditions, environmental condition (particularly temperature and humidity), dilution and sampling system conditions. Laboratory work and theory have shown that most of the nuclei mode formation and growth occur in the low dilution ratio range. In this range, gas to particle conversion of volatile particle precursors, like heavy hydrocarbons and sulfuric acid, leads to simultaneous nucleation and growth of the nuclei mode and adsorption onto existing particles in the accumulation mode. Laboratory tests (see e.g. SAE 980525 and SAE 2001-01-0201) have shown that nuclei mode formation increases strongly with decreasing air dilution temperature but there is conflicting evidence on whether humidity has an influence. \n\nGenerally, low temperature, low dilution ratios, high humidity and long residence times favour nanoparticles formation and growth. Studies have shown that nanoparticles consist mainly of volatile material like heavy hydrocarbons and sulfuric acid with evidence of solid fraction only at very high loads. \n\nContrastingly, engine-out size distributions of gasoline particulates in steady state operation show a unimodal distribution with a peak of about 60-80nm (see e.g.  FIG. 4 in SAE 1999-01-3530). By comparison with diesel size distribution, gasoline PM is predominantly ultrafine with negligible accumulation and coarse mode.\n\nParticulate collection of diesel particulates in a diesel particulate filter is based on the principle of separating gas-borne particulates from the gas phase using a porous barrier. Diesel filters can be defined as deep-bed filters and/or surface-type filters. In deep-bed filters, the mean pore size of filter media is bigger than the mean diameter of collected particles. The particles are deposited on the media through a combination of depth filtration mechanisms, including diffusional deposition (Brownian motion), inertial deposition (impaction) and flow-line interception (Brownian motion or inertia). \n\nIn surface-type filters, the pore diameter of the filter media is less than the diameter of the PM, so PM is separated by sieving. Separation is done by a build-up of collected diesel PM itself, which build-up is commonly referred to as “filtration cake” and the process as “cake filtration”. \n\nIt is understood that diesel particulate filters, such as ceramic wallflow monoliths, may work through a combination of depth and surface filtration: a filtration cake develops at higher soot loads when the depth filtration capacity is saturated and a particulate layer starts covering the filtration surface. Depth filtration is characterized by somewhat lower filtration efficiency and lower pressure drop than the cake filtration. \n\nWO 03/011437 discloses a gasoline engine having an exhaust system comprising means for trapping PM from the exhaust gas and a catalyst for catalysing the oxidation of the PM by carbon dioxide and/or water in the exhaust gas, which catalyst comprising a supported alkali metal. The means for trapping PM is suitable for trapping PM of particle range 10-100 nm, and can be a wallflow filter made from a ceramic material of appropriate pore size such as cordierite coated with the catalyst, a metal oxide foam supporting the catalyst, a wire mesh, a diesel wallflow filter designed for diesel applications, an electrophoretic trap or a thermophoretic trap (see e.g. GB-A-2350804). \n\nWO 2008/136232 A1 discloses a honeycomb filter having a cell wall composed of a porous cell wall base material and, provided on its inflow side only or on its inflow and outflow sides, a surface layer and satisfying the following requirements (1) to (5) is used as a diesel particulate filter: (1) the peak pore diameter of the surface layer is identical with or smaller than the average pore diameter of the cell wall base material, and the porosity of the surface layer is larger than that of the cell wall base material; (2) with respect to the surface layer, the peak pore diameter is from 0.3 to less than 20 ?m, and the porosity is from 60 to less than 95% (measured by mercury penetration method); (3) the thickness (L1) of the surface layer is from 0.5 to less than 30% of the thickness (L2) of the cell wall; (4) the mass of the surface layer per filtration area is from 0.01 to less than 6 mg/cm 2; and (5) with respect to the cell wall base material, the average pore diameter is from 10 to less than 60 ?m, and the porosity is from 40 to less than 65%. See also SAE paper no. 2009-01-0292.\n\nOther techniques suggested in the art for separating gasoline PM from the gas phase include vortex recovery. \n\nIn the United States, no similar emission standards have been set. However, the State of California Air Resources Board (CARB) recently published a paper entitled “Preliminary Discussion Paper—Amendments to California's Low-Emission Vehicle [LEV] Regulations for Criteria Pollutants—LEV III” (release date 8 th Feb. 2010) in which a new PM standard of between 2 and 4 mg PM/mile (1.25-2.50 mg PM/km (currently 10 mg PM/mile (6.25 mg PM/km))) is proposed, the paper commenting that: “Staff has received input from a number of manufacturers suggesting that a standard of 3 mg PM/mile (1.88 mg PM/km) can be met for gasoline direct injection engines without requiring the use of particulate filters.” Additionally, the paper states that since the PM mass and count emissions appear to be correlated: “Although a mandatory number standard is not being considered at this time, an optional PM number standard of about 1012 particles/mile [6.2511 particles/km] is being considered (which could be chosen by manufacturers instead of the PM mass standard)”. However, since neither the PM standard nor the PM number standard has been set by CARB yet, it is too soon to know whether particulate filtration will be necessary for the Californian or US vehicle market generally. It is nevertheless possible that certain vehicle manufacturers will choose filters in order to provide a margin of safety on any positive ignition engine design options selected to meet whatever standards are eventually set.\n\nThe new Euro 6 emission standard presents a number of challenging design problems for meeting gasoline emission standards. In particular, how to design a filter, or an exhaust system including a filter, for reducing the number of PM gasoline (positive ignition) emissions, yet at the same time meeting the emission standards for non-PM pollutants such as one or more of oxides of nitrogen (NO x), carbon monoxide (CO) and unburned hydrocarbons (HC), all at an acceptable back pressure, e.g. as measured by maximum on-cycle backpressure on the EU drive cycle.\n\nIt is envisaged that a minimum of particle reduction for a three-way catalysed particulate filter to meet the Euro 6 PM number standard relative to an equivalent flowthrough catalyst is ?50%. Additionally, while some backpressure increase for a three-way catalysed wallflow filter relative to an equivalent flowthrough catalyst is inevitable, in our experience peak backpressure over the MVEG-B drive cycle (average over three tests from “fresh”) for a majority of passenger vehicles should be limited to <200 mbar, such as <180 mbar, <150 mbar and preferably <120 mbar e.g. <100 mbar. \n\nPM generated by positive ignition engines has a significantly higher proportion of ultrafine, with negligible accumulation and coarse mode compared with that produced by diesel (compression ignition) engines, and this presents challenges to removing it from positive ignition engine exhaust gas in order to prevent its emission to atmosphere. In particular, since a majority of PM derived from a positive ignition engine is relatively small compared with the size distribution for diesel PM, it is not practically possible to use a filter substrate that promotes positive ignition PM surface-type cake filtration because the relatively low mean pore size of the filter substrate that would be required would produce impractically high backpressure in the system. \n\nFurthermore, generally it is not possible to use a conventional wallflow filter, designed for trapping diesel PM, for promoting surface-type filtration of PM from a positive ignition engine in order to meet relevant emission standards because there is generally less PM in positive ignition exhaust gas, so formation of a soot cake is less likely; and positive ignition exhaust gas temperatures are generally higher, which can lead to faster removal of PM by oxidation, thus preventing increased PM removal by cake filtration. Depth filtration of positive ignition PM in a conventional diesel wallflow filter is also difficult because the PM is significantly smaller than the pore size of the filter medium. Hence, in normal operation, an uncoated conventional diesel wallflow filter will have a lower filtration efficiency when used with a positive ignition engine than a compression ignition engine. \n\nAnother difficulty is combining filtration efficiency with a washcoat loading, e.g. of catalyst for meeting emission standards for non-PM pollutants, at acceptable backpressures. Diesel wallflow particulate filters in commercially available vehicles today have a mean pore size of about 13 ?m. However, we have found that washcoating a filter of this type at a sufficient catalyst loading such as is described in US 2006/0133969 to achieve required gasoline (positive ignition) emission standards can cause unacceptable backpres sure. \n\nIn order to reduce filter backpressure it is possible to reduce the length of the substrate. However, there is a finite level below which the backpressure increases as the filter length is reduced. Suitable filter lengths for filters according to embodiments of the present invention are from 2-12 inches long, preferably 3-6 inches long. Cross sections can be circular and in our development work we have used 4.66 and 5.66 inch diameter filters. However, cross-section can also be dictated by space on a vehicle into which the filter is required to fit. So for filters located in the so-called close coupled position, e.g. within 50 cm of the engine exhaust manifold where space is at a premium, elliptical or oval filter cross sections can be contemplated. As would be expected, backpressure also increases with washcoat loading and soot loading. \n\nThere have been a number of recent efforts to combine three-way catalysts with filters for meeting the Euro 6 emission standards. \n\nU.S. 2009/0193796 discloses a three-way conversion catalyst coated onto a particulate trap. The Examples disclose e.g. a soot filter having a catalytic material prepared using two coats: an inlet coat and an outlet coat. The mean pore size of the soot filter substrate used is not mentioned. The inlet coat contains alumina, an oxygen storage component (OSC) and rhodium all at a total loading of 0.17 g in  ?3; the outlet coat includes alumina, an OSC and palladium, all at a total loading of 0.42 g in?3. However, we believe that the three-way catalyst washcoat loading of <0.5 g in?3 provides insufficient three-way activity to meet the required emission standards alone, i.e. the claimed filter appears to be designed for inclusion in a system for location downstream of a three-way catalyst comprising a flowthrough substrate monolith.\n\nWO 2009/043390 discloses a catalytically active particulate filter comprising a filter element and a catalytically active coating composed of two layers. The first layer is in contact with the in-flowing exhaust gas while the second layer is in contact with the out-flowing exhaust gas. Both layers contain aluminium oxide. The first layer contains palladium, the second layer contains an oxygen-storing mixed cerium/zirconium oxide in addition to rhodium. In Examples, a wallflow filter substrate of unspecified mean pore size is coated with a first layer at a loading of approximately 31 g/l and a second layer at a loading of approximately 30 g/l. That is, the washcoat loading is less than 1.00 g in ?3. For a majority of vehicle applications, this coated filter is unlikely to be able to meet the required emission standards alone.\n\nA difficulty in coating a filter with a catalyst composition is to balance a desired catalytic activity, which generally increases with washcoat loading, with the backpressure that is caused by the filter in use (increased washcoat loading generally increases backpressure) and filtration efficiency (backpressure can be reduced by adopting wider mean pore size and higher porosity substrates at the expense of filtration efficiency). \n\nSUMMARY OF THE INVENTION \n\nAccording to an embodiment of the invention, we have now discovered, very surprisingly, that it is possible to adapt a relatively porous particulate filter—such as a particulate filter adapted for a diesel application—so that it can be used to trap e.g. ultrafine positive ignition PM at an acceptable pressure drop and backpressure. In particular, our inventors have determined that a washcoat that hinders access of the PM to a porous structure of a filter substrate can beneficially promote surface filtration substantially at the expense of depth filtration to the extent that cake filtration of PM derived from a positive ignition engine is promoted or enhanced. \n\nEarly indications suggest that positive ignition PM combusts in oxygen at lower temperatures than diesel PM. Investigations are continuing, but the invention makes use of this observation by providing means for trapping the positive ignition PM for combustion in oxygen. \n\nAccording to one aspect, the invention provides a filter for filtering particulate matter (PM) from exhaust gas emitted from an engine, such as a compression ignition engine or a positive ignition engine, e.g. a vehicular positive ignition engine such as a stoichiometrically-operated positive ignition engine or a lean burn positive ignition engine, which filter comprising a porous substrate having inlet surfaces and outlet surfaces, wherein the inlet surfaces are separated from the outlet surfaces by a porous structure containing pores, e.g. surface pores, of a first mean pore size, wherein the porous substrate is coated with a washcoat comprising a plurality of solid particles wherein the porous structure of the washcoated porous substrate contains pores of a second mean pore size, and wherein the second mean pore size is less than the first mean pore size. \n\nDETAILED DESCRIPTION OF THE INVENTION \n\nEarly indications are that at least some embodiments of the present invention directed to use with a positive ignition engine are capable of reducing positive ignition engine particle number emissions by >30% such as >50% e.g. >80% or even >90% at acceptable backpressure. \n\nMean pore size can be determined by mercury porosimetry. \n\nIt will be understood that the benefit of the invention is substantially independent of the porosity of the substrate. Porosity is a measure of the percentage of void space in a porous substrate and is related to backpressure in an exhaust system: generally, the lower the porosity, the higher the backpressure. However, the porosity of filters for use in the present embodiments of the invention are typically >40% or >50% and porosities of 45-75% such as 50-65% or 55-60% can be used with advantage. The mean pore size of the washcoated porous substrate is important for filtration. So, it is possible to have a porous substrate of relatively high porosity that is a poor filter because the mean pore size is also relatively high. \n\nThe porous substrate can be a metal, such as a sintered metal, or a ceramic, e.g. silicon carbide, cordierite, aluminium nitride, silicon nitride, aluminium titanate, alumina, cordierite, mullite e.g., acicular mullite (see e.g. WO 01/16050), pollucite, a thermet such as Al 2O3/Fe, Al2O3/Ni or B4C/Fe, or composites comprising segments of any two or more thereof. In a preferred embodiment, the filter is a wallflow filter comprising a ceramic porous filter substrate having a plurality of inlet channels and a plurality of outlet channels, wherein each inlet channel and each outlet channel is defined in part by a ceramic wall of porous structure, wherein each inlet channel is separated from an outlet channel by a ceramic wall of porous structure. This filter arrangement is also disclosed in SAE 810114, and reference can be made to this document for further details. Alternatively, the filter can be a foam, or a so-called partial filter, such as those disclosed in EP 1057519 or WO 01/080978.\n\nReasons motivating the coating of a wallflow filter for a diesel application are typically different from that of embodiments of the present invention directed to use with a positive ignition engine. In diesel applications, a washcoat is employed to introduce catalytic components to the filter substrate, e.g. catalysts for oxidising NO to NO 2, yet a significant problem is to avoid backpressure issues as soot is accumulated. Accordingly, a balance is struck between the desired catalytic activity and acceptable backpressure. Contrastingly, a primary motivating factor for washcoating a porous substrate for use of embodiments of the present invention directed to use with a positive ignition engine is to achieve both a desired filtration efficiency and catalytic activity.\n\nIn one embodiment, the first mean pore size e.g. of surface pores of the porous structure of the porous filter substrate is from 8 to 45 ?m, for example 8 to 25 ?m, 10 to 20 ?m or 10 to 15 ?m. In particular embodiments, the first mean pore size is >18 ?m such as from 15 to 45 ?m, 20 to 45 ?m e.g. 20 to 30 ?m, or 25 to 45 ?m. \n\nIn embodiments, the filter has a washcoat loading of >0.25 g in ?3, such as >0.5g in?3 or ?0.80 g in?3, e.g. 0.80 to 3.00 g in?3. In preferred embodiments, the washcoat loading is >1.00 g in?3 such as ?1.2 g in?3, >1.5 g in?3, >1.6 g in?3 or >2.00 g in ?3 or for example 1.6 to 2.4 g in?3. In particular combinations of filter mean pore size and washcoat loading the filter combines a desirable level of particulate filtration and catalytic activity at acceptable backpressure.\n\nIn a first, preferred embodiment, the filter comprises a surface washcoat, wherein a washcoat layer substantially covers surface pores of the porous structure and the pores of the washcoated porous substrate are defined in part by spaces between the particles (interparticle pores) in the washcoat. That is, substantially no washcoat enters the porous structure of the porous substrate. Methods of making surface coated porous filter substrates include introducing a polymer, e.g. poly vinyl alcohol (PVA), into the porous structure, applying a washcoat to the porous filter substrate including the polymer and drying, then calcining the coated substrate to burn out the polymer. A schematic representation of the first embodiment is shown in  FIG. 2A.\n\nMethods of coating porous filter substrates are known to the skilled person and include, without limitation, the method disclosed in WO 99/47260, i.e. a method of coating a monolithic support, comprising the steps of (a) locating a containment means on top of a support, (b) dosing a pre-determined quantity of a liquid component into said containment means, either in the order (a) then (b) or (b) then (a), and (c) by applying pressure or vacuum, drawing said liquid component into at least a portion of the support, and retaining substantially all of said quantity within the support. Such process steps can be repeated from another end of the monolithic support following drying of the first coating with optional firing/calcination. \n\nIn this first embodiment, an average interparticle pore size of the porous washcoat is 5.0 nm to 5.0 ?m, such as 0.1-1.0 ?m. \n\nA D90 of solid washcoat particles in this first, surface coating embodiment can be greater than the mean pore size of the porous filter substrate and can be in the range 10 to 40 ?m, such as 15 to 30 ?m or 12 to 25 ?m. “D90” as used herein defines the particle size distribution in a washcoat wherein 90% of the particles present have a diameter within the range specified. Alternatively, in embodiments, the mean size of the solid washcoat particles is in the range 1 to 20 ?m. It will be understood that the broader the range of particle sizes in the washcoat, the more likely that washcoat may enter the porous structure of the porous substrate. The term “substantially no washcoat enters the porous structure of the substrate” should therefore be interpreted accordingly. \n\nAccording to a second embodiment, the washcoat can be coated on inlet and/or outlet surfaces and also within the porous structure of the porous substrate. We believe that a surface coating around a pore opening at the inlet and/or outlet surfaces, thereby narrowing the e.g. surface pore size of a bare filter substrate, promotes interaction of the gas phase including PM without substantially restricting the pore volume, so not giving rise to significant increases in back pressure. That is, the pores at a surface of the porous structure comprise a pore opening and the washcoat causes a narrowing of substantially all the pore openings. A schematic representation of the second embodiment is shown in  FIG. 2B.\n\nMethods of making a filter according to the second embodiment can involve appropriate formulation of the washcoat known to the person skilled in the art including adjusting viscosity and surface wetting characteristics and application of an appropriate vacuum following coating of the porous substrate (see also WO 99/47260). \n\nIn the first and second embodiments, wherein at least part of the washcoat is coated on inlet and/or outlet surfaces of the porous substrate, the washcoat can be coated on the inlet surfaces, the outlet surfaces or on both the inlet and the outlet surfaces. Additionally either one or both of the inlet and outlet surfaces can include a plurality of washcoat layers, wherein each washcoat layer within the plurality of layers can be the same or different, e.g. the mean pore size in a first layer can be different from that of a second layer. In embodiments, washcoat intended for coating on outlet surfaces is not necessarily the same as for inlet surfaces. \n\nWhere both inlet and outlet surfaces are coated, the washcoat formulations can be the same or different. Where both the inlet and the outlet surfaces are washcoated, the mean pore size of washcoat on the inlet surfaces can be different from the mean pore size of washcoat on the outlet surfaces. For example, the mean pore size of washcoat on the inlet surfaces can be less than the mean pore size of washcoat on the outlet surfaces. In the latter case, a mean pore size of washcoat on the outlet surfaces can be greater than a mean pore size of the porous substrate. \n\nWhilst it is possible for the mean pore size of a washcoat applied to inlet surfaces to be greater than the mean pore size of the porous substrate, it is advantageous to have washcoat having smaller pores than the porous substrate in washcoat on inlet surfaces to prevent or reduce any combustion ash or debris entering the porous structure. \n\nAccording to a third embodiment, the washcoat sits substantially within, i.e. permeates, the porous structure of the porous substrate. A schematic representation of this third embodiment is shown in  FIG. 2C. Methods of making a filter according to the third embodiment include the appropriate formulation of the washcoat known to the person skilled in the art including viscosity adjustment, selection of low wetting characteristics and application of an appropriate vacuum following washcoating of the porous substrate (see also WO 99/47260). Alternatively, the porous substrate can be soaked in an appropriate solution of salts and the resulting product dried and calcined.\n\nEP 1663458 discloses a SCR filter, wherein the filter is a wallflow monolith and wherein an SCR catalyst composition permeates walls of the wallflow monolith. The specification discloses generally that the walls of the wallflow filter can contain thereon or therein (i.e. not both) one or more catalytic materials. According to the disclosure, “permeate”, when used to describe the dispersion of a catalyst slurry on the wallflow monolith substrate, means the catalyst composition is dispersed throughout the wall of the substrate. \n\nIn the...    1
????? \n\n??????????????????????????????????????????????????? \n\n???????????????? ??????????????\n\n????????????????????????????? \n??????????????????????????????????????????????????????????????????????????????????????????????????????????????????? \n???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? \n\n???????????????????? ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????\n\n??????? \n??????? \n????? \n??????? \n???? \n??????? \n????????? \n??????????? \n????????????? \n???????????????? \n?????? \n????????????? \n?????????????? \n???????????????? \n?????????????? \n?????????? \n????? \n????? \n\n???????????????????????? \n???????????????????????????????? \n??????????????????????????????????? \n???????????????????????????????? \n?????????????????????????????????????? \n???????????????????????????????????????????????????????????????????????????????????????? \n\n???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? \n\n????????????????????????????????????????????????????????????????????????????????????????????????????????????????? \n\n?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? \n\n????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? \n??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? \n\n????????????????????????????????????????????????????????????????????????????????????????????? \n???????????????????????????????????????????????????????????????????????????????????????? \n?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? \n\n???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? \n\n??????????????????????????????????????????????????????????????????????????????????????????????????????? \n\n?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? \n\n?????? \n??????????????????????????????? \n\n?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? \n\n????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? \n\n???????????????????????????????????????????????????????????????????????????????????? \n\n????????????????????????????????????????????????????????????????????????????????????????????????????????????????? \n\n??????????????????????????????????????????????????????????????????????????????????????????????????????????????????? \n\n?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? \n\n??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? \n\n???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????2????????????????????????????????????????????????????????????????????? \n\n?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? \n\n?????? \n?????????????????????????? \n?????????????????????????? \n??????????????????????????????????????????????????????????????? \n\n??????????????????????????????????????????????????????? \n\n?????? \n?????????????????????????? \n?????????????????????????? \n?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? \n\n????????????????????????????????????????????????????????????? \n\n???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? \n\n?????????????????????????????????????????????????????????????????????? \n??????????????????????????????????????????????????????????????????????????????????????????? \n\n??????????????????????????????????????????????????????????????????????????? \n\n?????????????????????????????????????????????????????????????? \n\n?????????????????????????????????????  | \n\nBRIEF DESCRIPTION OF THE DRAWINGS \n\nFIG. 1  is an overall view of a low back pain treatment tool according to Embodiment 1 of the present invention.\n\nFIG. 2  is a developed view of the low back pain treatment tool according to Embodiment 1 of the present invention.\n\nFIG. 3  is an overall view of a low back pain treatment tool according to Embodiment 2 of the present invention.\n\nFIG. 4  is an overall view of a low back pain treatment tool according to Embodiment 3 of the present invention.\n\nFIG. 5  is a schematic view showing a case where a wood hand/arm holding portion shown in Embodiment 1 of the present invention is used on the back of a recipient.\n\nFIG. 6  is a schematic view showing a case where the wood hand/arm holding portion shown in Embodiment 1 of the present invention is used as an armrest.\n\nFIG. 7  is a schematic view for explaining a case where the wood hand/arm holding portion shown in Embodiment 1 of the present invention is used in front of the recipient, with his/her chest and abdomen pressed against a posture holding surface. | \n\nTECHNICAL FIELD \n\nThe present invention relates to a low back pain treatment tool by means of correction of the sacrum, ilium, coccyx, or the like, or more specifically, by means of correction of the pelvis constituted thereby. \n\nBACKGROUND ART \n\nPelvis correction is the most common method of relieving low back pain. \n\nAs a conventional method for pelvis correction, there has been available a treatment method which uses a belt or traction device for fastening the pelvis. A temporary effect can be obtained by compressing only the pelvis using such a device, but the effect does not last very long: for example, the pain comes back after a predetermined period of time elapses since the end of the use of the belt or the like. \n\nExamples of such a device include the one that uses a geared motor (Patent Document 1) and the one that requires a recipient to perform light exercise (Patent Document 2). These devices should be used on a recipient who is in a sitting position, a supine position, or the like, and are not designed for correcting the pelvis while he/she raises his/her body up, or more specifically, is in a “standing position” which is a stable state for the lumbar vertebra. In addition, the use of a mechanical device such as a motor may lead to excessive correction depending on how it is used. \n\nPRIOR ART DOCUMENT \n\nPatent Document \n\nPatent Document 1: Japanese Unexamined Patent Application Publication No. 2010-188171 \n\nPatent Document 2: Japanese Unexamined Patent Application Publication No. 8-126718 \n\nSUMMARY OF THE INVENTION \n\nProblems to be Solved by the Invention \n\nThe followings are the problems to be solved. \n\n1. Only a temporary effect can be obtained by compressing the pelvis. \n\n2. The pelvis is not corrected while a recipient is in a “standing position” which is a stable state for the lumbar vertebra. \n\n3. A device which uses a motor may provide excessive correction. \n\n4. A device which requires light exercise lacks in convenience, and limits users who can use it. \n\nIn consideration of the above problems, it is an object of the present invention to provide a low back pain treatment tool which can correct the pelvis while a recipient is in a “standing position,” and which safely and properly corrects the pelvis by pressing the coccyx using the weight of the recipient. \n\nMeans for Solving the Problem \n\nAs described in claim  1, the present invention is a low back pain treatment tool comprising: a cylindrical casing elongated in a longitudinal direction; a coccyx contact treatment member which is slidably placed through an elastic member in an axial direction of the cylindrical casing; a coccyx contact buffering member which is provided on an upper end of the coccyx contact treatment member; a posture holding member having a posture holding surface in a longitudinal direction, which faces the cylindrical casing; and a handle fixed to the posture holding member.\n\nIn addition, as described in claim  2, the present invention is the low back pain treatment tool according to claim 1, wherein the cylindrical casing is fixed and supported on the posture holding member by fixing a horizontal seat plate vertically with respect to the posture holding surface and coupling a lower end of the cylindrical casing to an upper surface of the horizontal seat plate.\n\nFurther, as described in claim  3, the present invention is the low back pain treatment tool according to claim 1, wherein the cylindrical casing is fixed and supported on the posture holding member by fixing the posture holding member on a horizontal base plate, fixing a pair of left and right side plates orthogonally to a horizontal surface of the base plate and the posture holding surface, and attaching a horizontal seat plate between the side plates.\n\nStill further, as described in claim  4, the present invention is a low back pain treatment tool comprising: a cylindrical casing elongated in a longitudinal direction; a coccyx contact treatment member which is slidably placed through an elastic member in an axial direction of the cylindrical casing; a coccyx contact buffering member which is provided on an upper end of the coccyx contact treatment member; a posture holding member having a posture holding surface in a longitudinal direction, which faces the cylindrical casing; a handle fixed to the posture holding member; a horizontal seat plate which fixes and supports the cylindrical casing on the posture holding member by being fixed vertically with respect to the posture holding surface and coupling a lower end of the cylindrical casing to an upper surface of the horizontal seat plate; a horizontal base plate which fixes the posture holding member; a pair of left and right side plates which are fixed orthogonally to a horizontal surface of the base plate and the posture holding surface, and which support left and right sides of the horizontal base plate respectively; corner portions formed by an outer surface of either of the side plates, the posture holding surface, and a horizontal surface of the base plate; and rectangular parallelepiped foot rest blocks which are detachably placed at the corner portions.\n\nEffects of the Invention \n\nAccording to the invention set forth in claim  1, riding on the coccyx contact treatment member of the low back pain treatment tool in a “standing position” can restore the downward movement of the spine by upward vertical compression from immediately below the coccyx using the “weight of the recipient”.\n\nTreating a recipient in a “standing position” can allow positional correction of the sacrum, ilium, coccyx, or the like, or more specifically, correction of the pelvis constituted thereby, in a stable state for the lumbar vertebra, making it possible to continuously relieve low back pain. \n\nBy vertically vibrating the coccyx contact treatment member which is slidably placed through the elastic member, while riding on it, a recipient can finely adjust the position of the coccyx contact treatment member at the pelvis, so that he/she can achieve pelvis correction at a proper position. \n\nAccording to the invention set forth in claim  2, the cylinder casing is fixed and supported on the posture holding member by fixing the cylinder casing on the upper surface of the horizontal seat plate provided at a proper height, the length of the cylinder casing can be reduced. This prevents excessive moment force from being applied to the bolt which is located at the basal portion of the cylinder casing to fix it, thereby reducing the occurrence of failures. In addition, shorter length of the cylinder casing can save on costs.\n\nAccording to the invention set forth in claim  3, by providing the pair of left and right side surface plates fixed orthogonally to the horizontal seat plate and the posture holding surface of the posture holding member, the orientation of the horizontal seat plate can be kept constant even under load of the weight of the recipient.\n\nAccording to the invention set forth in claim  4, the rectangular parallelepiped foot rest blocks are stably provided in place at the corner portions, which are formed by three surfaces consisting of the outer surface of either of the side plates, the horizontal surface of the base plate, and the posture holding surface, so that the blocks can simultaneously come into contact with the surfaces. Thereby the recipient can more easily apply his/her weight to the coccyx contact treatment member in a “standing position” while riding on the treatment tool. More specifically, he/she can thereby appropriately select and easily adjust the height at which he/she can take his/her feet off the foot rest blocks while riding on the treatment tool, and can also make height adjustment in accordance with his/her height, before he/she uses the treatment tool. | \n\nBEST MODES FOR CARRYING OUT THE INVENTION \n\n(Embodiment 1) \n\nEmbodiment 1 of the present invention will be described below with reference to  FIGS. 1 and 2.\n\nWith a cylindrical casing  7 placed so that its axial direction is along the vertical direction, an inner cylindrical casing 8 and a coccyx contact treatment member 9a, each having a smaller diameter than that of the casing 7, are inserted thereinto. In this case, a coil spring as an elastic member 10 is provided below the inner cylindrical casing 8, and then the inner cylindrical casing 8 and the coccyx contact treatment member 9a are arranged so that they can slide vertically relative to the casing 7. With such an arrangement, the coccyx contact treatment member 9a is placed so that it can slide in the axial direction of the casing 7 through the elastic member 10.\n\nThe coccyx contact treatment member  9a has a cylindrical shape, is configured so that its diameter can be changed in accordance with the body size of a recipient, and has a flat surface to be contacted by the recipient. It should be noted, however, that a coccyx contact treatment member 9b having projections on the surface to be contacted by the recipient, may be used depending on the symptoms of low back pain of the recipient.\n\nA sponge is provided as a coccyx contact buffering member  11 in a center of a recipient-side end face of the coccyx contact treatment member 9a or 9b to avoid excessive compression of the coccyx of the recipient.\n\nA base for supporting the cylindrical casing  7 is constituted by a horizontal seat plate 6, a pair of side plates 3 provided on the left and right sides of the horizontal seat plate 6, and a base plate 5. The cylindrical casing 7 is fixed to the horizontal seat plate 6, which is a constitute element of the base, with bolts 12, washers 13, and nuts 14.\n\nA posture holding member  2 which is used by a recipient to hold his/her posture when he/she rides on the coccyx contact treatment member 9a has a posture holding surface of a plate-like shape elongated in the vertical direction, and is provided adjacent to the cylindrical casing 7 to be fixed to the base plate 5, side plates 3, and horizontal seat plate 6.\n\nA handle which is used by a recipient when he/she rides on the coccyx contact buffering member  11 is fixed to the posture holding member 2. Rectangular parallelepiped foot rest blocks 15 for a recipient are placed at corner portions formed by three surfaces consisting of the outer surface of either of the side plates 3, the posture holding surface of the posture holding member 2, and the horizontal surface of the base plate, so that the blocks can simultaneously come into contact with the surfaces.\n\nA method of using a low back pain treatment tool  1 according to the above-mentioned embodiment will be described with reference to FIG. 5. FIG. 5 is a view showing a case where a hand/arm holding portion 4 as a handle is used so that the back of a recipient comes into contact with the posture holding member 2. The recipient straddles the cylindrical casing 7 of the low back pain treatment tool 1 to place his/her coccyx on the coccyx contact buffering member 11. At this time, the recipient spreads his/her legs by about the breadth of his/her shoulders in a standing position. With his/her back against the posture holding member 2, the recipient then stretches his/her arms backward over the hand/arm holding portion 4 as a handle, bends his/her arms so that the handle is located on the inside of his/her elbows, and takes his/her forearms toward the front of him/her from below the handle. Thereby, the recipient can stably keep himself/herself in a standing position. Depending on the symptoms of his/her low back pain, he/she may correct his/her pelvis and relieve his/her pain by using the low back pain treatment tool 1 for five minutes per use and about two times per day.\n\nThe foot rest blocks  15 have a rectangular parallelepiped shape, and hence can be easily positioned at the corner portions formed by the three surfaces consisting of the outer surface of either of the side plates 3, the posture holding surface of the posture holding member 2, and the horizontal surface of the base plate 5, while simultaneously coming into contact with the three surfaces. Thereby the recipient can more easily apply his/her weight to the coccyx contact treatment member 11 in a “standing position” while riding on the treatment tool. More specifically, he/she can thereby appropriately select and easily adjust the height at which he/she can take his/her feet off the foot rest blocks while riding on the treatment tool, and can also make height adjustment in accordance with his/her height by stacking two or more foot rest blocks 15 or replacing the foot rest blocks 15 with ones of different heights, before he/she uses the treatment tool.\n\nThe coccyx contact treatment member  9a is slidably placed through the elastic member, and therefore, when the recipient places his/her coccyx on the coccyx contact buffering member 11, he/she finely adjusts the position of the coccyx contact treatment member 9a by vertically vibrating the coccyx contact treatment member 9a while riding on it. FIG. 6 is a view showing a case where the low back pain treatment tool according to the present invention is used with hand/arm holding portions 4 as handles being used as armrests. FIG. 7 is a view showing a case where the low back pain treatment tool according to the present invention is used with the chest and abdomen of a recipient pressed against the posture holding member 2.\n\n(Embodiment 2) \n\nEmbodiment 2 of the present invention will be described with reference to  FIG. 3.\n\nThe internal configuration of a cylindrical casing  7 is the same as that in Embodiment 1.\n\nIn this embodiment, the cylindrical casing  7 is directly fixed to a base plate 5, which is a constituent element of a base, with bolts 12, washers 13, and nuts 14.\n\nLonger longitudinal length of the cylindrical casing  7 reduces the number of components and allows simpler configuration as compared with Embodiment 1.\n\n(Embodiment 3) \n\nEmbodiment 3 of the present invention will be described with reference to  FIG. 4.\n\nThe internal configuration of a cylindrical casing  7 is the same as that in Embodiment 1.\n\nIn this embodiment, a base for supporting a cylindrical casing  7 is constituted by a horizontal seat plate 6 and a base plate 5. The cylindrical casing 7 is fixed to the horizontal seat plate 6, which is a constitute element of the base, with bolts 12, washers 13, and nuts 14. The horizontal seat plate 6 is fixed to a posture holding member 2 with shelf supports 17, and the posture holding member 2 is fixed to the base plate 5 with bolts.\n\nIn this embodiment, it is only required to fix the horizontal seat plate  6 to the posture holding member 2, and therefore, as in the second embodiment, the number of components is smaller and simpler configuration is possible than in Embodiment 1.\n\nThe upper end faces of the cylindrical casing  7 and the coccyx contact treatment member 9a are circular so as not to injure a recipient in FIG. 1, but are not limited to this, and may be elliptic for example. Further, in FIG. 1, the coccyx contact treatment member 9a is separated from an inner cylindrical casing 8 in consideration of the possibility that a recipient may change the shape of the coccyx contact treatment member 9a. However, no problem arises even if these components are integrated Again in FIG. 1, the coccyx contact treatment member 9a is smaller in diameter than the cylindrical casing 7, so that the coccyx contact treatment member 9a is placed inside the cylindrical casing 7. However, the present invention is not limited to this configuration, and the coccyx contact treatment member 9a may cover the cylindrical casing 7.\n\nThe elastic member  10 can be changed in accordance with the weight or symptoms of the recipient, and a coil spring is used in FIG. 2, but a leaf spring or rubber may be used as the elastic member 10.\n\nThe coccyx contact treatment member  9a or 9b comes into contact with a recipient, and hence is preferably made of wood. However, depending on the symptoms of the recipient, the coccyx contact treatment member 9a or 9b may be made of rubber which is softer than wood, or aluminum which is harder than wood.\n\nThe horizontal seat plate  6 and the cylindrical casing 7 are fixed with bolts in FIG. 2. However, the present invention is not limited to this, and they may be fixed, for example, with a wedge or by fitting.\n\nThe hand/arm holding portion  4 which is used as a handle in FIGS. 5 and 6 is rodlike. However, the shape of the hand/arm holding portion 4 is not limited to this, and may be platelike.\n\nReferring to  FIG. 3, the hand/arm holding portion 4 is coupled to the posture holding member 2 so as to allow height adjustment.\n\nDESCRIPTION OF REFERENCE NUMERALS \n\n1 : Low back pain treatment tool\n\n2 : Posture holding plate\n\n3 : Side plate\n\n4 : Hand/arm holding portion\n\n5 : Base plate\n\n6 : Horizontal seat plate\n\n7 : Cylindrical casing\n\n8 : Inner cylindrical casing\n\n9 a: Coccyx contact treatment member\n\n9 b: Coccyx contact treatment member having projections\n\n10 : Elastic member\n\n11 : Coccyx contact buffering member\n\n12 : Casing fixing bolt\n\n13 : Casing fixing washer\n\n14 : Casing fixing nut\n\n15 : Foot rest block\n\n16 : Human body\n\n17 : Shelf support                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    1
BRIEF DESCRIPTION OF THE DRAWINGS \n\nThe present invention will become more fully understood from the detailed description given hereinbelow and the accompanying drawings which are given by way of illustration only, and thus are not limitative of the present invention, and wherein: \n\nFIG. 1  is a whole configuration diagram showing the configuration of an electric clutch;\n\nFIG. 2  is a block diagram showing the whole configuration of a fail detecting device for a rotation angle sensor according to one embodiment of the present invention;\n\nFIG. 3  is an enlarged diagram of a cam;\n\nFIG. 4  is an explanatory diagram of the configuration of the cam;\n\nFIG. 5  is a graph showing the output characteristic of an angle sensor;\n\nFIG. 6  is a graph showing the sensor output of the angle sensor when the cam continuously rotates;\n\nFIG. 7  is a flowchart showing the procedure of angle sensor fail detection processing according to one embodiment of the present invention; and\n\nFIG. 8  is a sub-flowchart showing the procedure of sensor value comparison processing.\n\nCROSS-REFERENCE TO RELATED APPLICATIONS \n\nThe present application claims priority under 35 USC 119 to Japanese Patent Application No. 2010-068476 filed Mar. 25, 2011 the entire contents of which are hereby incorporated by reference. \n\nBACKGROUND OF THE INVENTION \n\n1. Field of the Invention \n\nThe present invention relates to a fail detecting device for a rotation angle sensor. More particularly to a fail detecting device for a rotation angle sensor for detecting the fail state of the rotation angle sensor that detects the rotation angle of an object to be detected. \n\n2. Description of Background Art \n\nConventionally, there has been known a configuration in which a plurality of rotation angle sensors are provided in a rotation angle detecting system to detect the rotation angle of a rotating body as preparation for the occurrence of a fail such as breakdown in the rotation angle sensor. \n\nJapanese Patent Laid-open No. 2005-265768 discloses a configuration in a rotation angle detecting system to detect the rotation angle of a ball bearing configured with a bearing ring composed of inner ring and outer ring. A plurality of spherical rolling elements rotate along the bearing ring with a cage that separates the rolling elements. More specifically, in this configuration, at least two rotation angle sensors formed of Hall elements are provided to detect the rotation angle of the cage. \n\nHowever, in the technique described in Japanese Patent Laid-open No. 2005-265768, although a fail can be easily detected by comparing the respective sensor outputs even when a fail such as breakdown has occurred in any sensor, there is a problem that the increase in the number of sensors causes an increase in the number of parts and an increase in the complexity of arithmetic processing, and so forth. \n\nSUMMARY AND OBJECTS OF THE INVENTION \n\nAn object of an embodiment of the present invention is to solve the above-described problem of the related art and provide a fail detecting device for a rotation angle sensor, capable of surely detecting a fail of the rotation angle sensor even if the number of rotation angle sensors that deal with an object to be detected is one. \n\nTo achieve the above-described object, according to an embodiment of the present invention, in a fail detecting device for a rotation angle sensor, having a cam ( 25) that has a cam surface in which an actuating surface (A, B) that reciprocates a push rod (35) and a non-actuating surface (C, D, E) that does not reciprocate the push rod (35) are continuously formed, an angle sensor (21) formed of an endless rotary potentiometer that detects the rotation angle of the cam (25) and has an output voltage (S) increasing in proportion to the rotation angle in a range of 360 degrees, and a controller (50) that detects a fail state of the angle sensor (21), the cam (25) is configured so as to be driven to rotate in one direction by an electric motor (1) controlled by the controller (50) to reciprocate the push rod (35). The output voltage (S) of the angle sensor (21) is set so that a region equal to or lower than a first predetermined voltage (V1) and a region equal to or higher than a second predetermined voltage (V2) higher than the first predetermined voltage (V1) are recognized as a dead zone (D). The controller (50) is configured so as to drive the rotation of the cam (25) to a predetermined position in the non-actuating surface (C, D, E) at a constant speed in transition of the cam surface of the cam (25) abutting against the push rod (35) from the side of the actuating surface (A, B) to the side of the non-actuating surface (C, D, E). The angle sensor (21) is configured so that the dead zone (D) is disposed at a position in the non-actuating surface (C, D, E) of the cam (25) and in an area in front of the predetermined position.\n\nAccording to an embodiment of the present invention, the controller ( 50) measures an elapsed time from transition of the cam surface to the dead zone (D) by a timer (54) and determines that the rotation angle sensor (21) is in the fail state if the output voltage (S) corresponding to the dead zone (D) is detected although an estimated time of passage through the dead zone (D) has elapsed.\n\nAccording to an embodiment of the present invention, the controller ( 50) measures an elapsed time from transition of the cam surface from the actuating surface (B) to the non-actuating surface (C) by a timer (54) and determines that the rotation angle sensor (21) is in the fail state if the output voltage (S) corresponding to the dead zone (D) is detected although an estimated time of passage through the dead zone (D) has elapsed.\n\nAccording to an embodiment of the present invention, the controller ( 50) stores the output voltage (S) of timing to transition to the dead zone (D) as a saved value (V2) and determines that the rotation angle sensor (21) is in the fail state if the output voltage (S) is the same as the saved value (V2) although an estimated time of passage through the dead zone (D) has elapsed and a predetermined time has elapsed in this state.\n\nAccording to an embodiment of the present invention, the controller ( 50) determines that the rotation angle sensor (21) is in the fail state if the output voltage (S) is outside a range between upper and lower limits set in advance although an estimated time of passage through the dead zone (D) has elapsed and a predetermined time has elapsed in this state.\n\nAccording to an embodiment of the present invention, the controller ( 50) stores the sensor value (S) of timing to transition to the dead zone (D) as a saved value (V2) and determines that the rotation angle sensor (21) is in the fail state if the output voltage (S) is not a value corresponding to the predetermined position in the non-actuating surface (E) although an estimated time of passage through the dead zone (D) has elapsed.\n\nAccording to an embodiment of the present invention, the cam is configured so as to be driven to rotate in one direction by the electric motor controlled by the controller and reciprocate the push rod. The output voltage of the angle sensor is set so that the region equal to or lower than the first predetermined voltage and the region equal to or higher than the second predetermined voltage higher than the first predetermined voltage are recognized as the dead zone. The controller is configured so as to drive rotation of the cam to a predetermined position in the non-actuating surface at a constant speed in the transition of the cam surface of the cam abutting against the push rod from the actuating surface side to the non-actuating surface side. The angle sensor is configured so that the dead zone is disposed at a position in the non-actuating surface of the cam and in an area in front of the predetermined position. Therefore, the predetermined time to reach to the predetermined position after the passage through the dead zone of the angle sensor in the transition of the cam from the actuating surface side to the non-actuating surface side is obtained in advance. Thus, for example if no change is observed in the sensor output although the predetermined time has elapsed from the entry into the dead zone, this can be determined to be the fail state of the angle sensor. This allows detection of the fail state of the rotation angle sensor even if the number of rotation angle sensors corresponding to the push rod is one, and thus can suppress increase in the number of parts and the cost. \n\nAccording to an embodiment of the present invention, the controller measures the elapsed time from the transition of the cam surface to the dead zone by the timer and determines that the rotation angle sensor is in the fail state if the output voltage corresponding to the dead zone is detected although the estimated time of the passage through the dead zone has elapsed. Thus, the time measurement by the timer is started at the timing of the transition to the dead zone. This enhances the reliability of the time measurement for detecting the dead zone passage. \n\nAccording to an embodiment of the present invention, the controller measures the elapsed time from the transition of the cam surface from the actuating surface to the non-actuating surface by the timer and determines that the rotation angle sensor is in the fail state if the output voltage corresponding to the dead zone is detected although the estimated time of the passage through the dead zone has elapsed. Thus, the time measurement by the timer is started at the timing of the transition of the cam surface from the actuating surface side to the non-actuating surface side. This enhances the reliability of the time measurement for detecting the dead zone passage. \n\nAccording to an embodiment of the present invention, the controller stores the output voltage of the timing to transition to the dead zone as the saved value and determines that the rotation angle sensor is in the fail state if the output voltage is the same as the saved value although the estimated time of the passage through the dead zone has elapsed and the predetermined time has elapsed in this state. Thus, the determination as to the fail state can be accurately made by comparison between the stored saved value and the present output voltage. \n\nAccording to an embodiment of the present invention, the controller determines that the rotation angle sensor is in the fail state if the output voltage is outside the range between the upper and lower limits set in advance although the estimated time of the passage through the dead zone has elapsed and the predetermined time has elapsed in this state. Thus, the determination as to the fail state can be accurately made by comparison between the upper and lower limits set in advance and the present output voltage. \n\nAccording to an embodiment of the present invention, the controller stores the sensor value of the timing to transition to the dead zone as the saved value and determines that the rotation angle sensor is in the fail state if the output voltage is not a value corresponding to the predetermined position in the non-actuating surface although the estimated time of the passage through the dead zone has elapsed. Thus, the determination as to the fail state can be accurately made based on the output voltage at a position except for the dead zone. \n\nFurther scope of applicability of the present invention will become apparent from the detailed description given hereinafter. However, it should be understood that the detailed description and specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description. \n\nDETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS \n\nPreferred embodiments of the present invention will be described in detail below with reference to the drawings.  FIG. 1 is a whole configuration diagram of an electric clutch 30 according to one embodiment of the present invention. The electric clutch 30 is e.g. a mechanism that is disposed between engine and transmission of a motorcycle or the like for controlling the disconnection and connection of the rotational driving force. The normally-open electric clutch 30 driven by an electric motor 1 is based on a double-spring system including a push spring 39 and a return spring 43 having spring rates different from each other as biasing members to bias the clutch in the open (disengagement) direction.\n\nThe electric clutch  30 is so configured that a cam shaft 23 on which a cam 25 is provided is driven to rotate to an arbitrary angle by the rotational driving force of the electric motor 1 to thereby reciprocate a push rod 35 abutting against the cam 25 and drive disengagement and engagement of the clutch.\n\nThe electric motor  1 has a rotor 4 formed integrally with an output shaft 5 and a stator 3 fixed to the inner circumference of a motor housing 2. A bearing 7 that pivotally supports the output shaft 5 is fitted into a base part 6 that seals the opening of the motor housing 2.\n\nA gear  8 formed at an end of the output shaft 5 is meshed with a first intermediate gear 9 that is pivotally supported by bearings 10 and 11 and is composed of two gears integrally formed. The rotational driving force transmitted to the first intermediate gear 9 is transmitted to an input gear 20 spline-fitted into the cam shaft 23 via a second intermediate gear 12 pivotally supported by bearings 13 and 14 and a third intermediate gear 16 pivotally supported by bearings 17 and 18. In the second intermediate gear 12, a tool attachment shaft 15 for allowing attachment of an emergency tool (not shown) to manually rotate the second intermediate gear 12 is provided.\n\nAt the upper end of the cam shaft  23 in the diagram, a rotation angle sensor (hereinafter, it will be often referred to simply as the angle sensor) 21 formed of a potentiometer to detect the rotation angle of the cam shaft 23 is provided. The cam shaft 23 is pivotally supported by a bearing 19 disposed close to the input gear 20 and bearings 24 and 26 disposed on both sides of the cam 25 in such a manner as to be freely rotatable. In the present embodiment, an oil seal 22 is disposed at substantially the intermediate part of the cam shaft 23. This allows e.g. a layout in which the mechanism from the electric clutch 30 to the cam 25 is housed in the crankcase of the engine whereas the mechanism from the electric motor 1 to the intermediate part of the cam shaft 23 is disposed outside the crankcase.\n\nThe electric clutch  30 is attached to one end of a main shaft 48 as the input shaft of the transmission (not shown). A primary driven gear 45 that is pivotally supported on the main shaft 48 in such a manner as to be freely rotatable and to which the rotational driving force is transmitted from the crankshaft (not shown) is connected to a clutch outer 41 via plural annular dampers 46. A bearing 47 of the main shaft 48 is disposed on the left side of the primary driven gear 45 in the diagram. When the electric clutch 30 becomes the engaged state, the rotational driving force of the clutch outer 41 is transmitted to the main shaft 48 via a clutch inner 44.\n\nMore specifically, when the push rod  35 is pushed to the left side in the diagram by the rotational driving force of the electric motor 1, a first push plate 36 is pressed via a bearing 34. The push spring 39 composed of a plurality of coil springs is disposed between the first push plate 36 and a second push plate 38. The return spring 43 composed of plural coil springs is disposed between the second push plate 38 and the clutch inner 44. The second push plate 38 is slid in the left direction in the diagram against the biasing force of both springs 39 and 43. Thereby, the clutch engagement operation is carried out.\n\nThe second push plate  38 is engaged with the clutch inner 44 in such a manner so as to give a predetermined preload to the return spring 43 and is fixed to the main shaft 48 by a nut 33 with the intermediary of a washer 32 to restrict the range of the slide in the right direction in the diagram. Furthermore, the range of the slide of the first push plate 36 in the right direction in the diagram is restricted by a circlip 37. When the second push plate 38 is slid in the left direction in the diagram, a clutch plate 42 is pressed in the left direction in the diagram by an annular pressing member 40 fixed to the second push plate 38. Thereby, the electric clutch 30 is switched from the disengaged state to the engaged state.\n\nFIG. 2  is a block diagram showing the whole configuration of the fail detecting device for a rotation angle sensor according to one embodiment of the present invention. The same numeral as that in the above description denotes the same or equivalent part. A controller 50 includes a sensor output recognizer 51 that recognizes the sensor output of the angle sensor 21, a sensor fail determiner 52 that determines the fail state of the angle sensor 21, a motor controller 53 that controls the electric motor 1, and a timer 54 that measures various predetermined times.\n\nThe sensor output recognizer  51 inputs the sensor output of the angle sensor 21 to the sensor fail determiner 52. The motor controller 53 inputs the control state of the electric motor 1 to the sensor fail determiner 52. The sensor fail determiner 52 detects the fail state of the angle sensor 21 based on the control state of the electric motor 1 and the measurement result of the timer 54 in addition to the sensor output from the angle sensor 21.\n\nFIG. 3  is an enlarged diagram of the cam 25. FIG. 4 is an explanatory diagram of the configuration of the cam 25. The cam 25 rotates integrally with the cam shaft 23 driven to rotate by the electric motor 1 to thereby reciprocate the push rod 35 that is supported so as to be capable of reciprocation in the left and right directions in the diagram.\n\nIn the cam  25, a continuous cam surface composed of cam surfaces 25a to 25e is formed. The cam 25 according to the present embodiment is driven by the electric motor 1 in such a manner so as to rotate only in the anticlockwise direction. Thereby, the cam surface abutting against the push rod 35 changes in the order of the cam surface 25a?25b?25c?25d?25e in association with the rotation of the cam 25.\n\nIn the present embodiment, the cam surface  25a that drives the clutch in the engagement direction is set as “engagement area A.” The cam surface 25b that drives the clutch in the disengagement direction is set as “disengagement area B.” The cam surface 25c that keeps the disengaged state of the clutch is set as “bridge area C.” The cam surface 25d that similarly keeps the disengaged state of the clutch is set as “dead zone D.” The cam surface 25e that similarly keeps the disengaged state of the clutch is set as “standby area E.” The disengagement area B is formed so that the rising (lift amount) of the cam surface 25b is small, and is configured so that the clutch can be rapidly switched from the state of being engaged by the cam surface 25a to the disengaged state by merely driving the electric motor 1 by a slight angle. The cam surfaces 25c, 25d, and 25e can be formed by a single circular arc.\n\nIn the present embodiment, the engagement area A and the disengagement area B will be collectively referred to as the “actuating surface” of the clutch. Furthermore, the bridge area C, the dead zone D, and the standby area E will be collectively referred to as the “non-actuating surface” of the clutch. The area that includes the position corresponding to 0 degrees as the rotation angle of the cam  25 and ranges between an angle ?1 and an angle ?2 is defined as the dead zone D. The area from the angle ?1 to 90 degrees is defined as the standby area E. The area from 90 degrees to 180 degrees is defined as the engagement area A. The area from 180 degrees to 270 degrees is defined as the disengagement area B. The area from 270 degrees to the angle ?2 is defined as the bridge area C.\n\nIn the present embodiment, in the transition of the cam  25 from the actuating surface to the non-actuating surface, the cam 25 is driven to rotate to a predetermined position in the non-actuating surface at a constant speed to prepare for the next clutch engagement operation. More specifically, in the transition of the cam 25 from the actuating surface to the non-actuating surface, i.e. in the transition from the disengagement area B to the bridge area C, the cam 25 is driven to rotate to a predetermined position in the standby area E at a constant speed. Due to this feature, the passage through the dead zone D located between the bridge area C and the standby area E is carried out at the constant speed necessarily.\n\nThe processing of driving the rotation of the cam  25 at a constant speed is started simultaneously with the detection of the boundary between the disengagement area B and the bridge area C and can be executed for a predetermined time in which the cam 25 can be surely rotated to the standby area E. The cam 25 may be stopped at a predetermined position in the standby area E based on the output of the angle sensor 21 after the processing is started simultaneously with detection of the boundary between the disengagement area B and the bridge area C.\n\nFIG. 5  is a graph showing the output characteristic of the angle sensor 21. FIG. 6 is a graph showing the sensor output of the angle sensor when the continuously rotates. As described above, the angle sensor 21 is an endless rotary potentiometer whose sensor output (output voltage) S increases in proportion to the rotation angle in the range of 360 degrees. More specifically, the sensor output S is 0 when the angle is 0 degrees. The sensor output S increases in proportion to the angle of rotation and 5 V as the maximum voltage is generated when the angle is 360 degrees. Therefore, if the cam 25 continuously rotates in one direction, a voltage waveform having such a form as to connect 0 V and 5 V is continuously output as shown in FIG. 6.\n\nIn the present embodiment, among the sensor outputs from 0 V to 5 V, only center values that can be expected to provide high accuracy are used as the effective sensor value and the other part is set as the “dead zone.” More specifically, the range from 0 degrees to the angle ? 1 corresponding to a sensor output V1 (first predetermined voltage) is set as a dead zone D1 and the range from the angle ?2 corresponding to a sensor output V2 (second predetermined voltage) to 360 degrees is set as a dead zone D2. The dead zones D1 and D2 will be collectively referred to as the dead zone D.\n\nThe fail detecting device for a rotation angle sensor according to the present invention is characterized in that the dead zone D of the angle sensor  21 is disposed on the non-actuating surface side of the cam 25 and in front of the position to which the cam 25 is driven to rotate at a constant speed in the transition from the disengagement area B to the bridge area C as shown in FIG. 4. Due to this feature, in the transition of the cam 25 from the actuating surface to the non-actuating surface, the passage through the dead zone D is carried out at the constant speed necessarily. Furthermore, because the cam 25 is necessarily rotated to the predetermined position at the constant speed in the transition of the cam 25 from the actuating surface to the non-actuating surface, the position of the cam 25 can be predicted by time measurement by the timer 54.\n\nIn view of the above-described characteristic, even an angle detecting system having only one angle sensor  21 can easily detect the fail state of the angle sensor 21. For example, the transition from the bridge area C to the dead zone D can be detected due to the reaching of the sensor output S to V2. Thus, if time measurement by the timer 54 is started in response to this transition, it can be determined that a fail has occurred in the angle sensor 21 based on a phenomenon that the sensor output still remains within the sensor output range corresponding to the dead zone D even after the elapse of a predetermined time.\n\nFurthermore, the motor controller  53 recognizes the drive signal to the electric motor 1. Thus, if the sensor output corresponding to the standby area E is not output as designed even after the end of the period in which the cam 25 is driven to the standby area E after the passage through the dead zone D at a constant speed, this can be determined to be the fail state of the angle sensor 21. Moreover, also if no change is observed in the sensor output although the electric motor 1 is being driven, this can be determined to be the fail state of the angle sensor 21. The above-described fail determination is made by the sensor fail determiner 52 shown in FIG. 2.\n\nFIG. 7  is a flowchart showing the procedure of angle sensor fail detection processing according to one embodiment of the present invention. FIG. 8 is a sub-flowchart showing the procedure of sensor value comparison processing. In a step S1, whether or not the clutch has been disengaged is determined. This determination can be made based on whether or not the sensor output S of the angle sensor 21 has become the value corresponding to the disengagement area B of the cam 25. Furthermore, it is also possible to detect whether or not the clutch has been disengaged based on the rotation speed ratio between the crankshaft and the transmission shaft.\n\nIf the positive determination is made in the step S 1, the processing proceeds to a step S2, where a sensor saved value before the entry into the dead zone D is recorded. This saved value is the sensor output S detected at the boundary of the bridge area C and the dead zone D of the cam 25. In the present embodiment, the saved value is V2 detected at the angle ?2.\n\nIn a subsequent step S 3, whether or not the cam 25 is moving to the standby area E is determined. This determination is made based on whether or not control of driving the rotation of the cam 25 to a predetermined position in the standby area E at a constant speed by the motor controller 53 is being carried out. The predetermined position in the standby area E can be arbitrarily set in advance.\n\nIf the positive determination is made in the step S 3, the processing proceeds to a step S4, where whether or not the estimated time of the dead zone passage has elapsed is determined. This determination can be made because the cam 25 is driven to rotate to a predetermined position in the standby area E at a constant speed in the transition from the disengagement area B to the bridge area C and time measurement by the timer 54 is started at a predetermined timing. The estimated time of the passage through the dead zone D can be calculated in advance based on the rotation speed of the cam 25. By starting the time measurement in response to detection of the boundary between the disengagement area B and the bridge area C of the cam 25 and by starting the time measurement in response to detection of the boundary between the bridge area C and the dead zone D, the completion timing of the passage through the dead zone D can be detected based on the output of the timer 54.\n\nIf the positive determination is made in the step S 4, the processing proceeds to a step S5, where the sensor value comparison processing is executed. Details of this processing will be described later. If the negative determination is made in the step S1, S3, or S4, the series of control is ended directly.\n\nFIG. 8  illustrates the sub-flow showing the procedure of the sensor value comparison processing in the above-described step S5. In a step S10, whether or not the sensor value is equal to or smaller than the set upper limit is determined. In this determination, it is determined whether or not the sensor output S sticks to the upper limit (e.g. 5 V) because any fail has occurred in the angle sensor 21. If the positive determination is made in the step S10, the processing proceeds to a step S11, where whether or not the sensor value is equal to or larger than the set lower limit is determined. In this determination, it is determined whether or not the sensor output S sticks to the lower limit (e.g. 0 V) because any fail has occurred in the angle sensor 21.\n\nNext, if a positive determination is made in step S 11, the processing proceeds to step S12, where whether or not the sensor value is in an unequal relationship with the sensor saved value is determined. This determination is made based on a prediction that the sensor output S should be a value different from the sensor saved value V2 after the passage through the dead zone D.\n\nSubsequently, if the positive determination is made in the step S 12, the processing proceeds to a step S13, where whether or not the sensor value is a value in the range corresponding to the standby area is determined. This determination is made based on a prediction that the sensor output S should be a value output in the standby area E after the passage through the dead zone D. If the positive determination is made in the step S13, it is determined that the angle sensor 21 is normally operating, so that the series of control is ended.\n\nIt is also possible to make the determination as to the fail state based on whether or not the sensor value is a value output in the dead zone. This determination is based on a prediction that the sensor output S should not be a value output in the dead zone D after the passage through the dead zone D. \n\nIf a negative determination is made in the step S 10, S11, S12, or S13, the processing proceeds to a step S14, where a fail detection mode starts based on a determination that possibly any fail has occurred in the angle sensor 21. In the fail detection mode, time measurement by the timer 54 is started. In a step S15, it is determined whether or not a predetermined time has elapsed from the start of the fail detection mode, i.e. from the appearance of suspicion of a fail. If the positive determination is made in step S15, the processing proceeds to step S16, where it is determined that the angle sensor 21 is in the fail state.\n\nAs described above, in the fail detecting device for a rotation angle sensor according to the present invention, the cam  25 is driven to rotate to a predetermined position in the standby area E at a constant speed in the transition of the cam 25 from the actuating surface to the non-actuating surface, i.e. in the transition from the disengagement area B to the bridge area C. Furthermore, the angle sensor 21 is so configured that the dead zone D is disposed at a position in the non-actuating surfaces C, D, and E of the cam 25 and in the area in front of the predetermined position. Therefore, the predetermined time to reach to the predetermined position after the passage through the dead zone of the angle sensor in the transition of the cam from the actuating surface side to the non-actuating surface side is obtained in advance. Thus, for example if no change is observed in the sensor output although the predetermined time has elapsed from the entry into the dead zone, this can be determined to be the fail state of the angle sensor. This allows even a rotation angle detecting system having only one angle sensor to detect the fail state of the angle sensor and thus can suppress increase in the ...    1
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ..
FIELD OF THE INVENTION \n\nThe present invention relates to stable liquid detergent compositions for dishes, comprising low branched anionic surfactants and branched nonionic surfactants that deliver effective grease-cleaning with enduring suds. \n\nBACKGROUND OF THE INVENTION \n\nConsumers desire hand dish-washing products that deliver both long lasting grease cleaning and long lasting suds. Additionally, more and more consumers are looking for products that contain a greater proportion of ingredients that are derived from natural, renewable sources. These include liquid hand dishwashing detergent compositions containing higher levels of surfactants derived from renewable sources, and having less surfactants derived from crude oil. However, since natural surfactants have little or no branching, such compositions produce lower levels of suds. Even worse, such detergent compositions have low suds-mileage. That is, the suds endurance is less than what most consumers would like. \n\nIn addition, high levels of linear anionic surfactants, such as those derived from renewable natural sources, but also linear synthetic surfactants, lead to worse stability of the resultant composition at low temperature. \n\nTherefore, a need remains for a liquid hand dishwashing detergent composition providing good cleaning and long lasting suds, while having excellent low temperature stability, which utilizes anionic surfactants having little or no branching. \n\nIt has been surprisingly found that small amounts of a branched, alkoxylated nonionic surfactant, in combination with ethoxylated anionic surfactants having little or no branching, provide excellent grease cleaning and long-lasting suds. More surprisingly, by using the branched alkoxylated nonionic surfactant, in combination with anionic surfactant having a minimum degree of ethoxylation and little or no branching, a liquid hand dishwashing detergent composition can be formulated having excellent low temperature stability. \n\nWO 9533025, U.S. Pat. No. 5,968,888, US 2007/0123447 A1, US 2005/0170990 A1, WO 2006/041740 A1, and U.S. Pat. No. 6,008,181 disclose liquid hand dishwashing detergent compositions comprising branched surfactants. \n\nSUMMARY OF THE INVENTION \n\nAccording to the present invention, there is provided a liquid hand dishwashing detergent composition comprising: from 2% to 70% by weight of an ethoxylated anionic surfactant derived from a fatty alcohol, wherein: at least 80% by weight of said fatty alcohol is linear, and said fatty alcohol has an average degree of ethoxylation of from 0.8 to 4; and from 0.1 to 5% by weight of an alkoxylated branched nonionic surfactant, having an average degree of alkoxylation of from 1 to 40; wherein the total amount of surfactant is from 10 to 85% by weight of the liquid detergent composition. The present invention further encompasses a method for hand washing dishes, using said composition, wherein the method comprises the step of contacting said composition in undiluted form, with the dish. \n\nDETAILED DESCRIPTION OF THE INVENTION \n\nAs used herein “liquid hand dishwashing detergent composition” refers to those compositions that are employed in manual (i.e. hand) cleaning of dishes. Such compositions are generally high sudsing or foaming in nature. As used herein “cleaning” means applying the liquid hand dishwashing detergent composition to a surface for the purpose of removing undesired residue such as soil, grease, stains and/or disinfecting. \n\nAs used herein “dish”, “dishes”, and “dishware” means a surface such as dishes, glasses, pots, pans, baking dishes and flatware, made from ceramic, china, metal, glass, plastic (polyethylene, polypropylene, polystyrene, etc.) and wood. \n\nAs used herein “grease” means materials comprising at least in part (i.e., at least 0.5 wt % by weight of the grease) saturated and unsaturated fats and oils, preferably oils and fats derived from animal sources such as beef and/or chicken. \n\nAs used herein “suds profile” means the amount of sudsing (high or low) and the persistence of sudsing (how sustained or long lasting the suds are) throughout the washing process, resulting from the use of the liquid detergent composition. As used herein “high sudsing” or “long lasting suds” refers to liquid hand dishwashing detergent compositions which both generate a high level of suds (i.e. a level of sudsing considered acceptable to the consumer) and where the level of suds is sustained during the dishwashing operation. This is particularly important with respect to liquid dishwashing detergent compositions as the consumer perceives high sudsing as an indicator of the performance of the detergent composition. Moreover, the consumer also uses the sudsing profile as an indicator that the wash solution still contains active detergent ingredients. The consumer usually applies additional liquid hand dishwashing detergent composition when the suds subside. Thus, low sudsing liquid dishwashing detergent composition formulation will tend to be used by the consumer more frequently than is necessary. \n\nBy “in its neat form”, it is meant herein that said composition is applied directly onto the surface to be treated, or onto a cleaning device or implement such as a dish cloth, a sponge or a dish brush without undergoing any significant dilution by the user (immediately) prior to application. “In its neat form”, also includes slight dilutions, for instance, arising from the presence of water on the cleaning device, or the addition of water by the consumer to remove the remaining quantities of the composition from a bottle. Therefore, the composition in its neat form includes mixtures having the composition and water at ratios ranging from 50:50 to 100:0, preferably 70:30 to 100:0, more preferably 80:20 to 100:0, even more preferably 90:10 to 100:0 depending on the user habits and the cleaning task. For the avoidance of doubt, a ratio of 100:0 is most preferred. \n\nBy “diluted form”, it is meant herein that said composition is diluted by the user, typically with water. By “rinsing”, it is meant herein contacting the dishes cleaned with the composition, with substantial quantities of water after the step of applying the liquid composition onto said dishes. By “substantial quantities”, it is meant usually 1 to 20 liters. \n\nAll percentages, ratios and proportions used herein are by weight percent of the liquid hand dishwashing detergent composition. All average values are calculated “by weight” of the liquid hand dishwashing detergent composition, unless otherwise expressly indicated. \n\nThe Liquid Hand Dishwashing Detergent Composition \n\nThe liquid hand dishwashing detergent compositions of the present invention are formulated to provide grease cleaning, long lasting suds and optional benefits that are often desired by the consumer. Optional benefits include soil removal, shine, and hand care. \n\nThe compositions of the present invention comprise at least one ethoxylated anionic surfactant, having little or no branching, and at least one branched, nonionic, alkoxylated surfactant. \n\nThe compositions herein may further comprise from 30% to 80% by weight of an aqueous liquid carrier, comprising water, in which the other essential and optional ingredients are dissolved, dispersed or suspended. More preferably the compositions of the present invention comprise from 45% to 70%, more preferable from 45% to 65% of the aqueous liquid carrier. Suitable optional ingredients include additional surfactant selected from other anionic surfactants, other nonionic surfactants, amphoteric/zwitterionic surfactants, cationic surfactants, and mixtures thereof; cleaning polymers; cationic polymers; enzymes; humectants; salts; solvents; hydrotropes; polymeric suds stabilizers; diamines; carboxylic acid; pearlescent agent; chelants; pH buffering agents; perfume; dyes; opacifiers; and mixtures thereof. \n\nThe aqueous liquid carrier, however, may contain other materials which are liquid, or which dissolve in the liquid carrier, at room temperature (20° C.-25° C.) and which may also serve some other function besides that of an inert filler. \n\nThe liquid detergent composition may have any suitable pH. Preferably the pH of the composition is adjusted to between 4 and 14. More preferably the composition has pH of from 6 to 13, most preferably from 6 to 10. The pH of the composition can be adjusted using pH modifying ingredients known in the art. \n\nThe liquid detergent composition of the present invention is preferably clear or transparent. That is, the liquid detergent composition has a turbidity of from 5 NTU to less than 3000 NTU, preferably less than 1000 NTU, more preferably less than 500 NTU and most preferably less than 100 NTU. \n\nThe Ethoxylated Anionic Surfactant \n\nThe liquid hand dishwashing detergent composition of the invention comprises from 2% to 70%, preferably from 5% to 30%, more preferably from 10% to 25% by weight of anionic surfactant having an average degree of ethoxylation of from 0.8 to 4, preferably from 1 to 2. The average degree of ethoxylation is defined as the average number of moles of ethylene oxide per mole of the ethoxylated anionic surfactant of the present invention. The ethoxylated anionic surfactant is derived from a fatty alcohol, wherein at least 80%, preferably at least 82%, more preferably at least 85%, most preferably at least 90% by weight of said fatty alcohol is linear. By linear, what is meant is that the fatty alcohol comprises a single backbone of carbon atoms, with no branches. Preferably, said ethoxylated anionic surfactant is an ethoxylated alkyl sulphate surfactant of formula:  \nR 1—(OCH2CH2)n—O—SO3?M+, wherein:\n    * R1 is a saturated or unsaturated C8-C16, preferably C12-C14 alkyl chain; preferably, R1 is a saturated C8-C16, more preferably a saturated C12-C14 alkyl chain;\n    * n is a number from 0.8 to 4, preferably from 1 to 2;\n    * M+ is a suitable cation which provides charge neutrality, preferably sodium, calcium, potassium, or magnesium, more preferably a sodium cation.\n\nSuitable ethoxylated alkyl sulphate surfactants include saturated C 8-C16 alkyl ethoxysulphates, preferably saturated C12-C14 alkyl ethoxysulphates.\n\nThe proportion of R 1 that is linear is such that at least 80% by weight of the starting fatty alcohol is linear. Saturated alkyl chains are preferred, since the presence of double bonds can lead to chemical reactions with other ingredients, such as certain perfume ingredients, or even with uv-light. Such reactions can lead to phase instabilities, discoloration and malodour.\n\nThe required carbon chain length distribution can be obtained by using alcohols with the corresponding chain length distribution prepared synthetically or from natural raw materials or corresponding pure starting compounds. Preferably, the anionic surfactant of the present invention is derived from a naturally sourced alcohol. Natural sources, such as plant or animal esters (waxes), can be made to yield linear chain alcohols with a terminal (primary) hydroxyl, along with varying degrees of unsaturation. Such fatty alcohols comprising alkyl chains ranging from C 8 to C16, may be prepared by any known commercial process, such as those deriving the fatty alcohol from fatty acids or methyl esters, and occasionally triglycerides. For example, the addition of hydrogen into the carboxyl group of the fatty acid to the form fatty alcohol, by treating with hydrogen under high pressure and in the presence of suitable metal catalysts. By a similar reaction, fatty alcohols can be prepared by the hydrogenation of glycerides or methyl esters. Methyl ester reduction is a suitable means of providing saturated fatty alcohols, and selective hydrogenation with the use of special catalysts such as copper or cadmium oxides can be used for the production of oleyl alcohol. Synthetic or petroleum-based processes, such as the Ziegler process, are useful for producing suitable straight chain, even-numbered, saturated alcohols. Paraffin oxidation is a suitable process for making mixed primary alcohols. The fatty alcohol may be reacted with ethylene oxide to yield ethoxylated fatty alcohols. The ethoxylated alkyl sulphate surfactant(s) of formula R1—(OCH2CH2)n—O—SO3?M+ may then be obtained by the sulphonation of the corresponding ethoxylated fatty alcohol(s).\n\nEthoxylated alkyl sulphate surfactant(s) of formula R 1—(OCH2CH2)n—O—SO3?M+, may be derived from coconut oil. Coconut oil usually comprises triglycerides which can be chemically processed to obtain a mixture of C12-C18 alcohols. A mixture of alkyl sulphates comprising a higher proportion of C12-C14 alkyl sulphates may be obtained by separating the corresponding alcohols before the ethoxylation or sulphation step, or by separating the obtained ethoxylated alcohol or ethoxylated alkyl sulphate surfactant(s).\n\nPreferred ethoxylated anionic surfactants herein are ethoxylated alkyl sulphates having from 8 to 18, preferably 10 to 16, more preferably 12 to 14 carbon atoms in the alkyl chain, and are from 80% to 100% linear. Such surfactants can be made by any known processes, using suitable feedstock. For instance, from linear fatty alcohols which are preferably naturally derived, such as n-dodecanol, n-tetradecanol and mixtures thereof. If desired, such surfactants can contain linear alkyl moieties derived from synthetic sources, or can comprise mixtures of the linear ethoxylated alkyl sulphates with lightly branched, e.g., methyl branched analogues. The ethoxylated alkyl sulphates can be in the form of their sodium, potassium, ammonium or alkanolamine salts. Suitable alcohol precursors for the ethoxylated anionic surfactants include Ziegler-derived linear alcohols, alcohols prepared by hydrogenation of oleochemicals, and 80% or more linear alcohols prepared by enrichment of the linear component of oxo derive alcohols, such as Neodol® or Dobanol® from Shell. Other examples of suitable primary alcohols include those derived from: natural linear fatty alcohols such as those commercially available from Procter & Gamble Co.; and the oxidation of paraffins by the steps of (a) oxidizing the paraffin to form a fatty carboxylic acid; and (b) reducing the carboxylic acid to the corresponding primary alcohol. Other preferred ethoxylated anionic surfactants are those from Sasol, sold under the tradenames: Alfol®, Nacol®, Nalfol®, Alchem®. \n\nThe Alkoxylated Branched Nonionic, Surfactant \n\nThe liquid hand dishwashing detergent compositions of the present invention comprise from 0.1% to 5%, preferably from 0.2% to 3%, more preferably from 0.5% to 2% by weight of alkoxylated branched nonionic surfactant. Said alkoxylated branched nonionic surfactant has an average degree of alkoxylation of from 1 to 40, preferably from 3 to 20, more preferably from 7 to 12. The average degree of alkoxylation is defined as the average number of moles of alkyl oxide per mole of the alkoxylated branched nonionic surfactant of the present invention. Preferably the branched nonionic is ethoxylated and/or propoxylated, more preferably ethoxylated. \n\nNon-ethoxylated branched nonionic surfactants in combination with the ethoxylated anionic surfactant of the present compositions have been found to limit the sudsing performance of the liquid detergent composition. Therefore, the composition preferably comprises less than 10%, more preferably less than 5%, most preferably less than 2% by weight of non-alkoxylated branched alcohol. For the surfactant to be suitably surface-active, the branched nonionic surfactant preferably comprises from 8 to 24, more preferably from 9 to 18, most preferably from 10 to 14 carbon atoms. Alkoxylated branched nonionic alcohols selected from: formula I, formula II, and mixtures thereof; are particularly preferred: \n\n\n wherein, in formula I:  \n    * R1 is a C5 to C16 linear or branched, preferably linear, alkyl chain;\n    * R2 is a C1 to C8 linear or branched, preferably linear, alkyl chain;\n    * R3 is H or C1 to C4 alkyl, preferably H or methyl;\n    * b is a number from 1 to 40, preferably from 5 to 20, more preferably from 7 to 12;\n\n\n wherein, in formula II:  \n    * R1 is a C6 to C16 linear or branched, preferably linear, alkyl chain;\n    * R2 is a C1 to C8 linear or branched, preferably linear, alkyl chain;\n    * R3 is H or C1 to C4 alkyl, preferably H or methyl;\n    * b is a number from 1 to 40, preferably from 5 to 20, more preferably from 7 to 12.\n\nThe degree of alkoxylation of said branched nonionic is preferably greater than the degree of ethoxylation of said ethoxylated anionic surfactant. As the degree of ethoxylation of the anionic surfactant is increased, the viscosity of the liquid hand dishwashing detergent composition increases. It is believed that this is because the hydrophilicity of the total surfactant system is increased. Moreover, liquid hand dishwashing detergent compositions are generally made using surfactant premixes. As the degree of ethoxylation of the anionic surfactant is increased, the likelihood of such surfactant premixes gelling during processing is increased. However, it has been discovered that by incorporating a small amount of branched nonionic surfactant, having a higher degree of alkoxylation than the degree of ethoxylation of the anionic surfactant, the viscosity of the surfactant premix, and resultant composition, can be controlled. \n\nAlkoxylated branched nonionic surfactants can be classified as relatively water insoluble or relatively water soluble. While certain alkoxylated branched nonionic surfactants can be considered water-insoluble, they can be formulated into liquid hand dishwashing detergent compositions of the present invention using suitable additional surfactants, particularly anionic or nonionic surfactants. \n\nPreferred branched nonionic surfactants according to formula I are the Guerbet C10 alcohol ethoxylates with 7 or 8 EO, such as Ethylan® 1007 & 1008, and the Guerbet C10 alcohol alkoxylated nonionic surfactants (which are ethoxylated and/or propoxylated) such as the commercially available Lutensol® XL series (X150, XL70. etc). Other exemplary alkoxylated branched nonionic surfactants include those available under the trade names: Lutensol® XP30, Lutensol® XP-50, and Lutensol® XP-80 available from BASF Corporation. In general, Lutensol® XP-30 can be considered to have 3 repeating ethoxy groups, Lutensol® XP-50 can be considered to have 5 repeating ethoxy groups, and Lutensol® XP-80 can be considered to have 8 repeating ethoxy groups. Other suitable branched nonionic surfactants include oxo branched nonionic surfactants such as the Lutensol® ON 50 (5 EO) and Lutensol® ON70 (7 EO). Also suitable are: the ethoxylated fatty alcohols originating from the Fischer & Tropsch reaction comprising up to 50% branching (40% methyl (mono or bi), 10% cyclohexyl) such as those produced from the Safol® alcohols from Sasol; ethoxylated fatty alcohols originating from the oxo reaction wherein at least 50% by weight of the alcohol is C2 isomer (methyl to pentyl) such as those produced from the Isalchem® alcohols or Lial® alcohols from Sasol. \n\nPreferred branched non-ionic ethoxylates according to formula II are those available under the tradenames Tergitol® 15-S, with an alkoxylation degree of from 3 to 40. For instance Tergitol® 15-S-20 which has an average degree of alkoxylation of 20. Other suitable commercially available material according to formula II are the ones available under the tradename Softanol® M and EP series. \n\nAdditional Surfactants \n\nThe composition of the present invention may comprise additional surfactant selected from other anionic, other nonionic, amphoteric/zwitterionic, cationic surfactants, and mixtures thereof. The liquid hand dishwashing compositions of the present invention comprise a total amount of surfactant of from 10% to 85% by weight, preferably from 12.5% to 65% by weight, more preferably 15% to 40% by weight of the composition. The total amount of surfactant is the sum of all the surfactants present, including the ethoxylated anionic surfactant, the alkoxylated branched nonionic surfactant, and any other anionic, other nonionic, amphoteric/zwitterionic, and cationic surfactants that may be present. \n\n1) Other Anionic Surfactants: \n\nThe composition of the present invention will typically comprise 2% to 70%, preferably 5% to 30%, more preferably 7.5% to 25%, and most preferably 10% to 20% by weight of anionic surfactant. \n\nSuitable anionic surfactants of use in the compositions and methods of the present invention are sulphates, sulphosuccinates, sulphonates, and/or sulphoacetates; preferably alkyl sulphates. Suitable sulphate or sulphonate surfactants for use in the compositions herein include water-soluble salts or acids of C 10-C14 alkyl or hydroxyalkyl, sulphate or sulphonates. Suitable counterions include hydrogen, alkali metal cation or ammonium or substituted ammonium, but preferably sodium. Where the hydrocarbyl chain is branched, it preferably comprises C1-4 alkyl branching units.\n\nThe sulphate or sulphonate surfactants may be selected from C 11-C18 alkyl benzene sulphonates (LAS), C8-C20 primary, branched chain and random alkyl sulphates (AS); C10-C18 secondary (2,3)alkyl sulphates; mid-chain branched alkyl sulphates as discussed in U.S. Pat. No. 6,020,303 and U.S. Pat. No. 6,060,443; modified alkylbenzene sulphonate (MLAS) as discussed in WO 99/05243, WO 99/05242, WO 99/05244, WO 99/05082, WO 99/05084, WO 99/05241, WO 99/07656, WO 00/23549, and WO 00/23548; methyl ester sulphonate (MES); and alpha-olefin sulphonate (AOS).\n\nThe paraffin sulphonates may be monosulphonates or disulphonates and usually are mixtures thereof, obtained by sulphonating paraffins of 10 to 20 carbon atoms. Preferred sulphonates are those of C12-18 carbon atoms chains and more preferably they are C14-17 chains. Paraffin sulphonates that have the sulphonate group(s) distributed along the paraffin chain are described in U.S. Pat. No. 2,503,280; U.S. Pat. No. 2,507,088; U.S. Pat. No. 3,260,744; U.S. Pat. No. 3,372,188 and in DE 735 096. \n\nAlso suitable are the alkyl glyceryl sulphonate surfactants and/or alkyl glyceryl sulphate surfactants described in the Procter & Gamble patent application WO06/014740: A mixture of oligomeric alkyl glyceryl sulfonate and/or sulphate surfactant selected from dimers, trimers, tetramers, pentamers, hexamers, heptamers, and mixtures thereof; wherein the weight percentage of monomers is from 0 wt % to 60 wt % by weight of the alkyl glyceryl sulfonate and/or sulphate surfactant mixture. \n\nOther suitable anionic surfactants are alkyl, preferably dialkyl sulphosuccinates and/or sulphoacetates. The dialkyl sulphosuccinates may be a C 6-15 linear or branched dialkyl sulphosuccinates. The alkyl moieties may be symmetrical (i.e., the same alkyl moieties) or asymmetrical (i.e., different alkyl moieties). Preferably, the alkyl moiety is symmetrical.\n\n2) Other Nonionic Surfactants \n\nThe liquid hand dishwashing detergent compositions may optionally comprise additional nonionic surfactant. The composition preferably comprises from 2% to 40%, more preferably from 3% to 30% by weight of nonionic surfactant. \n\nSuitable additional nonionic surfactants include the condensation products of aliphatic alcohols having from 1 to 25 moles of ethylene oxide. The alkyl chain of the aliphatic alcohol generally contains from 8 to 22 carbon atoms. Particularly preferred are the condensation products of alcohols having an alkyl group containing from 8 to 18 carbon atoms, more preferably from 9 to 15 carbon atoms, with from 2 to 18 moles, more preferably from 2 to 15 moles, most preferably from 5 to 12 moles of ethylene oxide per mole of alcohol. \n\nAlso suitable are alkylpolyglycosides having the formula R 2O(CnH2nO)t(glycosyl)x (formula (I)), wherein R2 of formula (I) is selected from the group consisting of alkyl, alkyl-phenyl, hydroxyalkyl, hydroxyalkylphenyl, and mixtures thereof in which the alkyl groups contain from 10 to 18, preferably from 12 to 14, carbon atoms; n of formula (I) is 2 or 3, preferably 2; t of formula (I) is from 0 to 10, preferably 0; and x of formula (I) is from 1.3 to 10, preferably from 1.3 to 3, most preferably from 1.3 to 2.7. The glycosyl is preferably derived from glucose. Also suitable are alkyl glycerol ethers and sorbitan esters.\n\nAlso suitable are fatty acid amide surfactants having the formula (II): \n\n\n wherein R 6 of formula (II) is an alkyl group containing from 7 to 21, preferably from 9 to 17, carbon atoms and each R7 of formula (II) is selected from the group consisting of hydrogen, C1-C4 alkyl, C1-C4 hydroxyalkyl, and —(C2H4O)xH where x of formula (II) varies from 1 to 3. Preferred amides are C8-C20 ammonia amides, monoethanolamides, diethanolamides, and isopropanolamides.\n\nPreferred nonionic surfactants for use in the present invention are the condensation products of aliphatic alcohols with ethylene oxide, such as the mixture of nonyl (C9), decyl (C10) undecyl (C11) alcohol modified with on average 5 ethylene oxide (EO) units such as the commercially available Neodol 91-5 or the Neodol 91-8 that is modified with on average 8 EO units. Also suitable are the longer alkyl chain ethoxylated nonionic surfactants such as C12, C13 modified with 5 EO (Neodol 23-5). Neodol is a Shell tradename. Also suitable is the C12, C14 alkyl chain with 7 EO, commercially available under the trade name Novel 1412-7 (Sasol) or the Lutensol A 7 N (BASF). \n\n3) Amphoteric/Zwitterionic Surfactants \n\nIt has been found that amphoteric/zwitterionic surfactants further enhance the sudsing profile, while providing excellent cleaning and being mild on the hands. The amphoteric and zwitterionic surfactant can be comprised at a level of from 0.01% to 20%, preferably from 0.2% to 15%, more preferably 0.5% to 10% by weight of the liquid hand dishwashing detergent compositions. Preferred amphoteric and zwitterionic surfactants are amine oxide surfactants, betaine surfactants, and mixtures thereof. \n\nMost preferred are amine oxides, especially coco dimethyl amine oxide or coco amido propyl dimethyl amine oxide. Amine oxide may have a linear or mid-branched alkyl moiety. Typical linear amine oxides include water-soluble amine oxides of formula R 1—N(R2)(R3)?O, wherein R1 is a C8-18 alkyl moiety; R2 and R3 are independently selected from the group consisting of C1-3 alkyl groups and C1-3 hydroxyalkyl groups and preferably include methyl, ethyl, propyl, isopropyl, 2-hydroxethyl, 2-hydroxypropyl and 3-hydroxypropyl. The linear amine oxide surfactants in particular may include linear C10-C18 alkyl dimethyl amine oxides and linear C8-C12 alkoxy ethyl dihydroxy ethyl amine oxides. Preferred amine oxides include linear C10, linear C10-C12, and linear C12-C14 alkyl dimethyl amine oxides. As used herein “mid-branched” means that the amine oxide has one alkyl moiety having n1 carbon atoms with one alkyl branch on the alkyl moiety having n2 carbon atoms. The alkyl branch is located on the ? carbon from the nitrogen on the alkyl moiety. This type of branching for the amine oxide is also known in the art as an internal amine oxide. The total sum of n1 and n2 is from 10 to 24 carbon atoms, preferably from 12 to 20, and more preferably from 10 to 16. The number of carbon atoms for the one alkyl moiety (n1) should be approximately the same number of carbon atoms as the one alkyl branch (n2) such that the one alkyl moiety and the one alkyl branch are symmetric. As used herein “symmetric” means that |n1?n2| is less than or equal to 5, preferably less than 4 carbon atoms in at least 50 wt %, more preferably at least 75 wt % to 100 wt % of the mid-branched amine oxides for use herein.\n\nThe amine oxide further comprises two moieties, independently selected from a C 1-3 alkyl, a C1-3 hydroxyalkyl group, or a polyethylene oxide group containing an average of from 1 to 3 ethylene oxide groups. Preferably the two moieties are selected from a C1-3 alkyl, more preferably both are selected as a C1 alkyl.\n\nOther suitable surfactants include betaines such as: alkyl betaines, alkylamidobetaines, amidazoliniumbetaines, sulphobetaines (INCI Sultaines) and phosphobetaines, that preferably meets formula (III):  \nR 1—[CO—X(CH2)n]x—N+(R2)(R3)—(CH2)m—[CH(OH)—CH2]y—Y—??(III) wherein\n    * R1 is a saturated or unsaturated C6-22 alkyl chain, preferably a C8-18 alkyl chain, more preferably a saturated C10-16 alkyl chain, most preferably a saturated C12-14 alkyl chain;\n    * X is selected from the group consisting of: NH, NR4, O, and S; wherein R4 is a C1-4 Alkyl chain;\n    * n is an integer from 1 to 10, preferably from 2 to 5, more preferably 3;\n    * x is either 0 or 1, preferably 1;\n    * R2, R3 are independently selected from C1-4 alkyl chains, preferably a methyl chain; R2, R3 may also be hydroxy substituted such as hydroxyethyl or hydroxymethyl chain;\n    * m is an integer from 1 to 4, preferably 1, 2 or 3;\n    * y is either 0 or 1; and\n    * Y is selected from the group consisting of: COO, SO3, OPO(OR5)O and P(O)(OR5)O; wherein R5 is H or a C1-4 alkyl chain.\n\nPreferred betaines are the alkyl betaines of the formula (IIIa), the alkyl amido betaine of the formula (IIIb), the sulphobetaines of the formula (IIIc) and the amido sulphobetaine of the formula (IIId);  \nR 1—N+(CH3)2—CH2COO???(IIIa)\nR 1—CO—NH(CH2)3—N+(CH3)2—CH2COO???(IIIb)\nR 1—N+(CH3)2—CH2CH(OH)CH2SO3—??(IIIc)\nR 1—CO—NH—(CH2)3—N+(CH3)2—CH2CH(OH)CH2SO3—??(IIId)\n in which R 1 has the same meaning as in formula III. Particularly preferred betaines are the carbobetaines [wherein Y??COO?], in particular the carbobetaine of the formula (IIIa) and (IIIb), more preferred are the alkylamidobetaines of the formula (IIIb).\n\nExamples of suitable betaines and sulphobetaine are the following [designated in accordance with INCI]: Almondamidopropyl of betaines, Apricotamidopropyl betaines, Avocadamidopropyl of betaines, Babassuamidopropyl of betaines, Behenamidopropyl betaines, Behenyl of betaines, betaines, Canolamidopropyl betaines, Capryl/Capramidopropyl betaines, Carnitine, Cetyl of betaines, Cocamidoethyl of betaines, Cocamidopropyl betaines, Cocamidopropyl Hydroxysultaine, Coco betaines, Coco Hydroxysultaine, Coco/Oleamidopropyl betaines, Coco Sultaine, Decyl of betaines, Dihydroxyethyl Oleyl Glycinate, Dihydroxyethyl Soy Glycinate, Dihydroxyethyl Stearyl Glycinate, Dihydroxyethyl Tallow Glycinate, Dimethicone Propyl of PG-betaines, Erucamidopropyl Hydroxysultaine, Hydrogenated Tallow of betaines, Isostearam idopropyl betaines, Lauramidopropyl betaines, Lauryl of betaines, Lauryl Hydroxysultaine, Lauryl Sultaine, MiIkamidopropyl betaines, Minkamidopropyl of betaines, Myristamidopropyl betaines, Myristyl of betaines, Oleamidopropyl betaines, Oleamidopropyl Hydroxysultaine, Oleyl of betaines, Olivamidopropyl of betaines, Palmam idopropyl betaines, Palm itam idopropyl betaines, Palmitoyl Carnitine, Palm Kernelamidopropyl betaines, Polytetrafluoroethylene Acetoxypropyl of betaines, Ricinoleamidopropyl betaines, Sesam idopropyl betaines, Soyamidopropyl betaines, Stearamidopropyl betaines, Stearyl of betaines, Tallowamidopropyl betaines, Tallowamidopropyl Hydroxysultaine, Tallow of betaines, Tallow Dihydroxyethyl of betaines, Undecylenamidopropyl betaines and Wheat Germamidopropyl betaines. \n\nA preferred betaine is, for example, Cocoamidopropyl betaine (Cocoamidopropyl betaine). \n\nA preferred surfactant system is a mixture of anionic surfactant and amphoteric or zwitterionic surfactants in a ratio within ...    1
This application is a continuation of U.S. patent application Ser. No. 12/899,416, filed Oct. 6, 2010, which claims the benefit of Indian Provisional Patent Application Nos. 2439/CHE/2009 dated 8 Oct. 2009; 2636/CHE/2009 dated 30 Oct. 2009; 158/CHE/2010 dated 25 Jan. 2010; 1513/CHE/2010 dated 2 Jun. 2010; and 1514/CHE/2010 dated 2 Jun. 2010; and, and U.S. Provisional Patent Application No. 61/265,540 dated 1 Dec. 2009, each of which is hereby incorporated by reference. \n\nFIELD OF THE INVENTION \n\nThe present invention relates to calcium release-activated calcium (CRAC) channel inhibitors of formula I and pharmaceutically acceptable salts thereof, methods for preparing them, pharmaceutical compositions containing them, and methods of treatment with them. \n\nBACKGROUND OF THE INVENTION \n\nThe regulation of intracellular calcium is a key element in the transduction of signals into and within cells. Cellular responses to growth factors, neurotransmitters, hormones and a variety of other signal molecules are initiated through calcium-dependent processes. The importance of calcium ion as a second messenger is emphasised by many different mechanisms which work together to maintain calcium homeostasis. Changes in intracellular free calcium ion concentration represent the most wide-spread and important signalling event for regulating a plethora of cellular responses. A widespread route for calcium ion entry into the cell is through store-operated channels (SOCs), i.e. many cell types employ store-operated calcium ion entry as their principal pathway for calcium ion influx. This mechanism is engaged following calcium ion release from stores, where the depleted stores lead to activation of calcium release-activated calcium (CRAC) channels. \n\nCRAC channels, a subfamily of store-operated channels, are activated by the release of calcium from intracellular stores, particularly from the endoplasmic reticulum (ER). These channels are key factors in the regulation of a wide range of cellular function, including muscle contraction, protein and fluid secretion and control over cell growth and proliferation and hence play an essential role in various diseases such as immune disorders and allergic responses. Among several biophysically distinct store-operated currents the best characterized and most calcium ion selective one is the CRAC current. Thus, CRAC channels mediate essential functions from secretion to gene expression and cell growth and form a network essential for the activation of immune cells that establish the adaptive immune response. Recently two proteins, stromal interaction molecule (STIM1) and CRAC Modulator 1 (CRACM1 or Orai1), have been identified as the essential components that fully reconstitute and amplify CRAC currents in heterologous expression systems with a similar biophysical fingerprint. In mammals, there exist several homologs of these proteins: STIM1 and STIM2 in the endoplasmic reticulum and CRACM1, CRACM2, and CRACM3 in the plasma membrane. \n\nCRAC currents were initially discovered in lymphocytes and mast cells, and at the same time have been characterized in various cell lines such as S2 drosophila, DT40 B cells, hepatocytes, dendritic, megakaryotic, and MadinDarby canine kidney cells. In lymphocytes and in mast cells, activation through antigen or Fc receptors initiates the release of calcium ion from intracellular stores caused by the second messenger inositol (1,4,5)-triphosphate (Ins(1,4,5)P 3), which in turn leads to calcium ion influx through CRAC channels in the plasma membrane. Store-operated Ca2+ currents characterized in smooth muscle, A431 epidermal cells, endothelial cells from various tissues, and prostate cancer cell lines show altered biophysical characteristics suggesting a distinct molecular origin.\n\nFor example, calcium ion influx across the cell membrane is important in lymphocyte activation and adaptive immune responses. [Ca 2+]-oscillations triggered through stimulation of the TCR (T-cell antigen receptor) have been demonstrated to be prominent, and appear to involve only a single calcium ion influx pathway, the store-operated CRAC channel See, e.g., Lewis “Calcium signalling mechanisms in T lymphocytes,” Annu. Rev. Immunol. 19, (2001), 497-521; Feske et al. “Ca++ calcineurin signalling in cells of the immune system,” Biochem. Biophys. Res. Commun 311, (2003, 1117-1132; Hogan et al. “Transcriptional regulation by calcium, calcineurin, and NFAT,” Genes Dev. 17, (2003) 2205-2232.\n\nIt is well established now that intracellular calcium plays an important role in various cellular functions, and that its concentration is regulated by calcium ion influx through calcium channels on the cell membrane. Calcium ion channels, which are located in the nervous, endocrine, cardiovascular, and skeletal systems and are modulated by membrane potential, are called voltage-operated Ca 2+ (VOC) channels. These channels are classified into L, N, P, Q, R, and T subtypes. Excessive Ca2+ influx through the VOC channels causes hypertension and brain dysfunction. In contrast, calcium ion channels on inflammatory cells, including lymphocytes, mast cells, and neutrophils, can be activated regardless of their membrane potential. This type of calcium ion channel has been reported to act in the crisis and exacerbation of inflammation and autoimmune diseases. In the T cells, it has been reported that the early stages of activation consist of pre- and post-Ca2+ events. The stimulation of T cell receptors induces pre-Ca2+ events, including the generation of IP3, followed by the release of Ca2+ from the endoplasmic reticulum (ER). In post-Ca2+ events, depletion of Ca2+ in the ER induces the activation of CRAC channels, and capacitative Ca2+ influx through the CRAC channel sustains high intracellular Ca2+ concentration ([Ca2+]i). This prolonged high [Ca2+]i activates cytosolic signal transduction to produce lipid mediators (e.g., LTD4), cytokines [e.g., interleukin-2 (IL-2)], and matrix metalloproteinases, which participate in the pathogenesis of inflammation and autoimmune diseases.\n\nThese facts suggest that CRAC channel modulators can be useful for the treatment of diseases caused by the activation of inflammatory cells without side effects observed in steroids. Since VOC channel modulators would cause adverse events in the nervous and cardiovascular systems, it may be necessary for CRAC channel modulators to exhibit sufficient selectivity over VOC channels if they are to be used as anti-inflammatory drugs. \n\nAccordingly, CRAC channel modulators have been said to be useful in treatment, prevention and/or amelioration of diseases or disorders associated with calcium release-activated calcium channel including, but not limited to, inflammation, glomerulonephritis, uveitis, hepatic diseases or disorders, renal diseases or disorders, chronic obstructive pulmonary disease, rheumatoid arthritis, inflammatory bowel disease, vasculitis, dermatitis, osteoarthritis, inflammatory muscle disease, allergic rhinitis, vaginitis, interstitial cystitis, scleroderma, osteoporosis, eczema, allogeneic or xenogeneic transplantation, graft rejection, graft-versus-host disease, lupus erythematosus, type I diabetes, pulmonary fibrosis, dermatomyositis, thyroiditis, myasthenia gravis, autoimmune hemolytic anemia, cystic fibrosis, chronic relapsing hepatitis, primary biliary cirrhosis, allergic conjunctivitis, hepatitis and atopic dermatitis, asthma, Sjogren's syndrome, cancer and other proliferative diseases, and autoimmune diseases or disorders. See, e.g., International Publication Nos. WO 2005/009954, WO 2005/009539, WO 2005/009954, WO 2006/034402, WO 2006/081389, WO 2006/081391, WO 2007/087429, WO 2007/087427, WO 2007087441, WO 200/7087442, WO 2007/087443, WO 2007/089904, WO 2007109362, WO 2007/112093, WO 2008/039520, WO 2008/063504, WO 2008/103310, WO 2009/017818, WO 2009/017819, WO 2009/017831, WO 2010/039238, WO 2010/039237, WO 2010/039236, WO 2009/089305 and WO 2009/038775, and US Publication Nos.: US 2006/0173006 and US 2007/0249051. \n\nCRAC channel inhibitors which have been identified include SK&F 96365 (1), Econazole (2) and L-651582 (3). \n\nHowever, these molecules lack sufficient potency and selectivity over VOC channels and hence are not suitable for therapeutic use. \n\nRecent publications by Taiji et al. ( European Journal of Pharmacology, 560, 225-233, 2007) and Yasurio Yonetoky et al. (Bio. & Med. Chem., 16, 9457-9466, 2008) describe a selective CRAC channel inhibitor coded YM-58483 that is capable of inhibiting T cell function and proposed to be of some benefit in the treatment of inflammatory diseases including bronchial asthma.\n\nYasurio Yonetoky et al. disclose YM-58483 to be selective for CRAC channels over the voltage operated channels (VOC) with a selective index of 31. \n\nOther CRAC channel modulators disclosed include various biaryl and/or heterocyclic carboxanilide compounds including for example PCT or US patent applications assigned to Synta Pharmaceuticals viz. WO 2005/009954, WO 2005/009539, WO 2005/009954, WO 2006/034402, WO 2006/081389, WO 2006/081391, WO 2007/087429, WO 2007/087427, WO 2007087441, WO 200/7087442, WO 2007/087443, WO 2007/089904, WO 2007109362, WO 2007/112093, WO 2008/039520, WO 2008/063504, WO 2008/103310, WO 2009/017818, WO 2009/017819, WO 2009/017831, WO 2010/039238, WO 2010/039237, WO 2010/039236, WO 2009/089305 and WO 2009/038775, US 2006/0173006 and US 2007/0249051. \n\nOther patent publications relating to CRAC channel modulators include applications by Astellas, Queens Medical Centre, Calcimedica and others viz., WO 2007/121186, WO 2006/050214, WO 2007/139926, WO 2008/148108, U.S. Pat. No. 7,452,675, US 2009/023177, WO 2007/139926, U.S. Pat. No. 6,696,267, U.S. Pat. No. 6,348,480, WO 2008/106731, US 2008/0293092, WO 2010/048559, WO 2010/027875, WO2010/025295, WO 2010/034011, WO2010/034003, WO 2009/076454, WO 2009/035818, US 2010/0152241, US 2010/0087415, US 2009/0311720 and WO 2004/078995. \n\nFurther review and literature disclosure in the area of CRAC channels includes Isabella Derler et al.,  Expert Opinion in Drug Discovery, 3(7), 787-800, 2008; Yousang G et al., Cell Calcium, 42, 145-156, 2007; Yasurio Yonetoky et. al., Bio. & Med. Chem., 14, 4750-4760, 2006; and Yasurio Yonetoky et. al., Bio. & Med. Chem., 14, 5370-5383, 2006. All of these patents and/or patent applications and literature disclosures are incorporated herein by reference in their entirety for all purposes.\n\nCancer is a major public health problem in India, the U.S. and many other parts of the world. Currently, 1 in 4 deaths in India is due to cancer. Lung cancer is the leading cause of cancer deaths worldwide because of its high incidence and mortality, with 5-year survival estimates of ˜10% for non-small cell lung cancer (NSCLC). It has been reported that further investigations on the mechanisms of tumorigenesis and chemoresistance of lung cancer are needed to improve the survival rate (Jemal A, et al.,  Cancer Statistics, CA Cancer. J. Chn., 56, 106-130, 2006). There are four major types of NSCLC, namely, adenocarcinoma, squamous cell carcinoma, bronchoalveolar carcinoma, and large cell carcinoma. Adenocarcinoma and squamous cell carcinoma are the most common types of NSCLC based on cellular morphology (Travis et al., Lung Cancer Principles and Practice, Lippincott-Raven, New York, 361-395, 1996). Adenocarcinomas are characterized by a more peripheral location in the lung and often have a mutation in the K-ras oncogene (Gazdar et al., Anticancer Res., 14, 261-267, 1994). Squamous cell carcinomas are typically more centrally located and frequently carry p53 gene mutations (Niklinska et al., Folia Histochem. Cytobiol., 39, 147-148, 2001).\n\nThe majority of NSCLCs are characterized by the presence of the ras mutation thereby rendering the patient relatively insensitive to treatment by known kinase inhibitors. As a result, current treatments of lung cancer are generally limited to cytotoxic drugs, surgery, and radiation therapy. There is a need for treatments which have fewer side effects and more specifically target the cancer cells, are less invasive, and improve the prognosis of patients. \n\nThe identification of lung tumor-initiating cells and associated markers may be useful for optimization of therapeutic approaches and for predictive and prognostic information in lung cancer patients. Accordingly, a need remains for new methods of predicting, evaluating and treating patients afflicted with lung cancer. \n\nThere still remains an unmet and dire need for small molecule modulators having specificity towards Stim1 and/or Orai1 in order to regulate and/or modulate activity of CRAC channels, particularly for the treatment of diseases and disorders associated with the CRAC. \n\nSUMMARY OF THE INVENTION \n\nThe present invention relates to compounds of formula (I), methods for their preparation, pharmaceutical compositions containing them, and methods of treatment with them. \n\nIn particular, compounds of formula (I) and their pharmaceutically acceptable salts thereof are calcium release-activated calcium channel modulators useful in the treatment, prevention, inhibition and/or amelioration of diseases or disorders associated with calcium release-activated calcium channel. \n\nIn one aspect, the present invention relates to a compound of formula (I): \n\n\n or a tautomer thereof, prodrug thereof, N-oxide thereof, pharmaceutically acceptable ester thereof or pharmaceutically acceptable salt thereof,  \n wherein \n\nRing Hy represents \n\nRing Hy is optionally substituted with R??; \n\nR 1 and R2 are the same or different and are independently selected from CH3, CH2F, CHF2, CF3, substituted or unsubstituted C(3-5) cycloalkyl, CH2—ORa, CH2—NRaRb, CN and COOH with the proviso that:\n\na) both R 1 and R2 at the same time do not represent CF3,\n\nb) both R 1 and R2 at the same time do not represent CH3,\n\nc) when R 1 is CF3 then R2 is not CH3 and\n\nd) when R 1 is CH3 then R2 is not CF3;\n\nRing Ar represents: \n\nT, U, V and W are the same or different and are independently selected from CR a and N;\n\nZ 1, Z2 and Z3 are the same or different and are independently selected from CRa, CRaRb, O, S and —NRa, with the proviso that at least one of Z1, Z2 and Z3 represents O, S or —NRa;\n\nL 1 and L2 together represent —NH—C(?X)—, —NH—S(?O)q—, —C(?X)NH—, —NH—CR?R? or —S(?O)qNH—;\n\nA is absent or selected from —(CR?R?)—, O, S(?O) q, C(?X) and —NRa;\n\neach occurrence of R? and R? are the same or different and are independently selected from hydrogen, hydroxy, cyano, halogen, —OR a, —COORa, —S(?O)q—Ra, —NRaRb, —C(?X)—Ra, substituted or unsubstituted C(1-6) alkyl group, substituted or unsubstituted C(1-6) alkenyl, substituted or unsubstituted C(1-6) alkynyl, and substituted or unsubstituted C(3-5)cycloalkyl, or R? and R? directly bound to a common atom, may be joined to form a substituted or unsubstituted saturated or unsaturated 3-6 member ring, which may optionally include one or more heteroatoms which may be same or different and are selected from O, NRa and S;\n\nR?? is selected from hydrogen, hydroxy, cyano, halogen, —OR a, —COORa, —S(?O)q—Ra, —NRaRb, —C(?X)—Ra, substituted or unsubstituted C(1-6) alkyl group, substituted or unsubstituted C(1-6) alkenyl, substituted or unsubstituted C(1-6) alkynyl, and substituted or unsubstituted C(3-5)cycloalkyl;\n\neach occurrence of X is independently selected from O, S and —NR a;\n\nCy is selected from monocyclic substituted or unsubstituted cycloalkyl group, monocyclic substituted or unsubstituted heterocyclyl, monocyclic substituted or unsubstituted aryl, and monocyclic substituted or unsubstituted heteroaryl; \n\neach occurrence of R a and Rb are the same or different and are independently selected from hydrogen, nitro, hydroxy, cyano, halogen, —ORc, —S(?O)q—Rc, —NRcRd, —C(?Y)—Rc, —CRcRd—C(?Y)—Rc, —CRcRd—Y—CRcRd—, —C(?Y)—NRcRd—, —NRRd—C(?Y)—NRcRd—, —S(?O)q—NRcRd—, —NRcRd—S(?O)q—NRcRd—, —NRcRd—NRcRd—, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted cycloalkylakyl, substituted or unsubstituted cycloalkenyl, substituted or unsubstituted heterocylyl, substituted or unsubstituted heterocyclylalkyl, substituted or unsubstituted aryl, substituted or unsubstituted arylalkyl, substituted or unsubstituted heteroaryl, and substituted or unsubstituted heteroarylalkyl, or when Ra and Rb are directly bound to the same atom, they may be joined to form a substituted or unsubstituted saturated or unsaturated 3-10 membered ring, which may optionally include one or more heteroatoms which may be same or different and are selected from O, NRc and S;\n\neach occurrence of R c and Rd may be same or different and are independently selected from hydrogen, nitro, hydroxy, cyano, halogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted cycloalkylakyl, substituted or unsubstituted cycloalkenyl, substituted or unsubstituted heterocyclic group, substituted or unsubstituted heterocyclylalkyl, or when two Rc and/or Rd substitutents are directly bound to the same atom, they may be joined to form a substituted or unsubstituted saturated or unsaturated 3-10 membered ring, which may optionally include one or more heteroatoms which are the same or different and are selected from O, NH and S;\n\neach occurrence of Y is selected from O, S and —NR a; and\n\neach occurrence of q independently represents an integer 0, 1 or 2; with Proviso (e) that the compound of formula (I) is not:  \n    * N-[4-[5-cyclopropyl-3-(trifluoromethyl)-1H-pyrazol-1-yl]phenyl]-1-(difluoromethyl)-5-methyl-1H-pyrazole-3-carboxamide;\n    * N-[4-[5-cyclopropyl-3-(trifluoromethyl)-1H-pyrazol-1-yl]phenyl]-1-methyl-4-nitro-1H-pyrazole-5-carboxamide;\n    * N-[4-[5-cyclopropyl-3-(trifluoromethyl)-1H-pyrazol-1-yl]phenyl]-3-(1-ethyl-5-methyl-1H-pyrazol-4-yl)-5-isoxazolecarboxamide;\n    * N-[4-[5-cyclopropyl-3-(trifluoromethyl)-1H-pyrazol-1-yl]phenyl]-4,5-dihydro-3-(2-methoxyphenyl)-5-isoxazolecarboxamide;\n    * N-[4-[5-cyclopropyl-3-(trifluoromethyl)-1H-pyrazol-1-yl]phenyl]-2-[4-(1,1-dimethylethyl)phenyl]-cyclopropanecarboxamide;\n    * N-[4-[5-cyclopropyl-3-(trifluoromethyl)-1H-pyrazol-1-yl]phenyl]-3-pyridine carboxamide;\n    * N-[4-[3-cyclopropyl-5-(trifluoromethyl)-1H-pyrazol-1-yl]phenyl]-3-pyridine carboxamide; or\n    * N-benzyl-6-(3,5-dicyclopropyl-1H-pyrazol-1-yl)pyridazin-3-amine\n\nIn one preferred embodiment, R 1 is cyclopropyl.\n\nIn one preferred embodiment, R 2 is CF3.\n\nAccording to one preferred embodiment, Hy is \n\nFurther preferred is a compound of formula (I) wherein Hy is \n\nFurther preferred is a compound of formula (I) wherein Hy is \n\nAccording to one preferred embodiment, Ar is \n\nFurther preferred is a compound of formula (I) wherein Ar is \n\nFurther preferred is a compound of formula (I) wherein Ar is \n\nAccording to one preferred embodiment, L 1 and L2 together represent —NH—C(?O)—, —NH—S(?O)q—, —C(?O)NH— or NH—CH2—.\n\nAccording to one preferred embodiment, A is absent or selected from —(CR?R?)—, O, S(?O) q, C(?X) and —NRa. More preferably, A is —CH2—, —CHMe- or —(CR?R?)—, where R? and R? are joined to form a substituted or unsubstituted saturated or unsaturated 3-6 member ring, which may optionally include one or more heteroatoms which are the same or different and are selected from O, NRa (such as NH) and S;\n\nFurther preferred is a compound of formula (I) wherein A is \n\nFurther preferred is a compound of formula (I) wherein A is \n\nFurther preferred is a compound of formula (I) wherein A is absent. \n\nFurther preferred is a compound of formula (I) wherein A is —CH 2—.\n\nAccording to one preferred embodiment, Cy is \n\nFurther preferred is a compound of formula (I) wherein Cy is \n\nFurther preferred is a compound of formula (I) wherein Cy is \n\nFurther preferred is a compound of formula (I) wherein Cy is \n\nYet another embodiment is a compound having the formula (IA): \n\n\n or a tautomer thereof, prodrug thereof, N-oxide thereof, pharmaceutically acceptable ester thereof, or pharmaceutically acceptable salt thereof, wherein the variables (e.g., R??, R 1, R2, T, U, V, W, L1, L2, A and Cy) are defined as described above in relation to formula (I), with the proviso that the compound of formula (IA) is not any of the compounds in Proviso ((a-e) as defined above.\n\nYet another embodiment is a compound having the formula (IA-I) \n\n\n or a tautomer thereof, prodrug thereof, N-oxide thereof, pharmaceutically acceptable ester thereof, or pharmaceutically acceptable salt thereof, wherein the variables (e.g., R??, R 1, R2, T, U, V, W, A and Cy) are defined as described above in relation to formula (I), \n with the proviso that the compound of formula (IA) is not any of the compounds in Proviso (a-e) defined above. \n\nFurther preferred is a compound of formula (IA-I) \n\n\n or a tautomer thereof, prodrug thereof, N-oxide thereof, pharmaceutically acceptable ester thereof, or pharmaceutically acceptable salt thereof, wherein \n\nR 1 and R2 are the same or different and are independently selected from CH2F, CHF2, CF3 and cyclopropyl; with the proviso that\n\na) both R 1 and R2 at the same time do not represent CF3,\n\n; \n\nR?? is hydrogen or halogen; \n\nT, U, V, W are independently CR a or N;\n\nR a is hydrogen or halogen;\n\nA is absent; and \n\nCy is selected from monocyclic substituted or unsubstituted aryl or monocyclic substituted or unsubstituted heteroaryl, \n\nwith the proviso that the compound of formula (IA) is not any of the compounds in Proviso (e) defined above. \n\nFurther preferred is a compound of formula (IA-I) wherein both R 1 and R2 represent cyclopropyl.\n\nFurther preferred is a compound of formula (IA-I) wherein one of R 1 and R2 is CF3 and the other is cyclopropyl.\n\nFurther preferred is a compound of formula (IA-I) wherein R 1 is cyclopropyl and R2 is CF3.\n\nFurther preferred is a compound of formula (IA-I) wherein T, U, V, W are CH, CF or N. \n\nFurther preferred is a compound of formula (IA-I) wherein T is CF or N and each of U, V and W is CH. \n\nFurther preferred is a compound of formula (IA-I) wherein each of T and V is CF or N and each of U and W is CH. \n\nFurther preferred is a compound of formula (IA-I) wherein A is absent \n\nFurther preferred is a compound of formula (IA-I) wherein Cy is selected from \n\nFurther preferred is a compound of formula (IA-I) wherein Cy is \n\nYet another embodiment is a compound having the formula (IA-III) \n\nor a tautomer, prodrug, N-oxide, pharmaceutically acceptable ester, or pharmaceutically acceptable salt thereof, \n\nwherein \n\nR 1 and R2 are the same or different and are independently selected from CH2F, CHF2, CF3, Cyclopropyl with the proviso that both R1 and R2 at the same time do not represent CF3;\n\nT and V are the same or different and are independently selected from CF and N; \n\nEach of U and V is CR a;\n\nL 1 and L2 together represent —NH—C(?X)—, —NH—S(?O)q—, —C(?X)NH—, or —S(?O)qNH— or —NH—CR?R?—;\n\nA is absent or selected from —(CR?R?)- and —NR a;\n\neach occurrence of R? and R? are the same or different and are independently selected from hydrogen or substituted or unsubstituted C (1-6) alkyl group or R? and R? may be joined to form a substituted or unsubstituted saturated or unsaturated 3-6 membered ring, which may optionally include one or more heteroatoms which may be same or different and are selected from O, NRa and S;\n\nR?? is selected from the group consisting of hydrogen, or halogen \n\neach occurrence of X is independently selected from O, S and —NR a;\n\nCy is selected from monocyclic substituted or unsubstituted heterocyclyl, monocyclic substituted or unsubstituted aryl, and monocyclic substituted or unsubstituted heteroaryl. \n\neach occurrence of R a and Rb are the same or different and are independently selected from hydrogen, nitro, hydroxy, cyano, halogen, —ORc, —S(?O)q—Rc, —NRcRd, —C(?Y)—Rc, —CRcRd—C(?Y)—Rc, —CRcRd—Y—CRcRd—, —C(?Y)—NRcRd—, —NRRd—C(?Y)—NRcRd—, —S(?O)q—NRcRd—, —NRcRd—S(?O)q—NRcRd—, —NRcRd—NRcRd—, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted cycloalkylakyl, substituted or unsubstituted cycloalkenyl, substituted or unsubstituted heterocylyl, substituted or unsubstituted heterocyclylalkyl, substituted or unsubstituted aryl, substituted or unsubstituted arylalkyl, substituted or unsubstituted heteroaryl, and substituted or unsubstituted heteroarylalkyl, or when Ra and Rb substitutent are directly bound to the same atom, they may be joined to form a substituted or unsubstituted saturated or unsaturated 3-10 member ring, which may optionally include one or more heteroatoms which may be same or different and are selected from O, NRc and S;\n\neach occurrence of R c and Rd may be same or different and are independently selected from the group consisting of hydrogen, nitro, hydroxy, cyano, halogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted cycloalkylakyl, substituted or unsubstituted cycloalkenyl, substituted or unsubstituted heterocyclic group, substituted or unsubstituted heterocyclylalkyl, or when two Rc and/or Rd substitutents are directly bound to the same atom, they may be joined to form a substituted or unsubstituted saturated or unsaturated 3-10 member ring, which may optionally include one or more heteroatoms which are the same or different and are selected from O, NH and S;\n\neach occurrence of Y is selected from O, S and —NR a; and\n\neach occurrence of q independently represents 0, 1 or 2. \n\nFurther preferred is a compound of formula (IA-III) wherein both R 1 and R2 represent cyclopropyl.\n\nFurther preferred is a compound of formula (IA-III) wherein one of R 1 and R2 is CF3 and the other is cyclopropyl.\n\nFurther preferred is a compound of formula (IA-III) wherein one of R 1 and R2 is CF3 and the other is CH2F, CHF2.\n\nFurther preferred is a compound of formula (IA-III) wherein R 1 is cyclopropyl and R2 is CF3.\n\nFurther preferred is a compound of formula (IA-III) wherein T is CF or N. \n\nFurther preferred is a compound of formula (IA-III) wherein U, V, W are CH, CF or N. \n\nFurther preferred is a compound of formula (IA-III) wherein L 1 and L2 together represent —NH—C(?O)—, C(?O)NH— or —NH—CH2—;\n\nFurther preferred is a compound of formula (IA-III) wherein A is absent, —NH— or —CH 2—.\n\nFurther preferred is a compound of formula (IA-III) wherein Cy is selected from \n\nFurther preferred is a compound of formula (IA-III) wherein Cy is selected from \n\nRepresentative compounds of the present invention include those specified below and in Table 1 and pharmaceutically acceptable salts thereof. The present invention should not be construed to be limited to them.  \n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)phenyl]-4-methyl-1,2,3-thiadiazole-5-carboxamide\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)phenyl]-4-methylthiazole-5-carboxamide\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)phenyl]-2,4-dimethylthiazole-5-carboxamide\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)phenyl]-5-methylisoxazole-4-carboxamide\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)phenyl]-3,5-dimethylisoxazole-4-carboxamide\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)phenyl]benzamide\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)phenyl]-2-methylbenzamide\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)phenyl]-2,6-difluorobenzamide\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)phenyl]-2,3-difluorobenzamide\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)phenyl-3-(methylsulfonyl)benzamide\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)phenyl]-4-(methylsulfonyl)benzamide\n    * 2-chloro-N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)phenyl]-5-(methylthio)benzamide\n    * 2-chloro-N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)phenyl)-5-(methylsulfonyl)benzamide\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)phenyl]nicotinamide hydrochloride\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)phenyl]isonicotinamide hydrochloride\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)phenyl]-3-fluoroisonicotinamide\n    * 3,5-dichloro-N-(4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)phenyl)isonicotinamide\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)phenyl]-4-methylpyrimidine-5-carboxamide\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)phenyl]-2-phenylacetamide\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)phenyl]-2-(4-fluorophenyl)acetamide\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)phenyl]-1-phenylcyclopropanecarboxamide\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)phenyl]-2-(pyridin-2-yl)acetamide hydrochloride\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)phenyl]-2-(pyridin-3-yl)acetamide hydrochloride\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)phenyl]-2-(pyridin-4-yl)acetamide hydrochloride\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)phenyl]-2-(piperazin-1-yl)acetamide hydrochloride\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)phenyl]-2-morpholinoacetamide\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)phenyl]benzenesulfonamide\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)-3-fluorophenyl]-4-methyl-1,2,3-thiadiazole-5-carboxamide\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)-3-fluorophenyl]-4-methylthiazole-5-carboxamide\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)-3-fluorophenyl]-3,5-dimethylisoxazole-4-carboxamide\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)-3-fluorophenyl]-2-methylbenzamide\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)-3-fluorophenyl]-2,3-difluorobenzamide\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)-3-fluorophenyl]-2,6-difluorobenzamide\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)-3-fluorophenyl]nicotinamide hydrochloride\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)-3-fluorophenyl]isonicotinamide hydrochloride\n    * N-[4-(3,5-dicyclopropyl-1H-pyrazol-1-yl)-3-fluorophenyl]-4-methylpyrimidine-5-carboxamide\n    * N-[4-(4-chloro-3,5-dicyclopropyl-1H-pyrazol-1-yl)-3-fluorophenyl]-4-methyl-1,2,3-thiadiazole-5-carboxamide\n    * N-[6-(3,5-dicyclopropyl-1H-pyrazol-1-yl)pyridin-3-yl]-4-methyl-1,2,3-thiadiazole-5-carboxamide hydrochloride\n    * N-[6-(3,5-dicyclopropyl-1H-pyrazol-1-yl)pyridin-3-yl]-4-methylthiazole-5-carboxamide hydrochloride\n    * N-[6-(3,5-dicyclopropyl-1H-pyrazol-1-yl)pyridin-3-yl]-2,4-dimethylthiazole-5-carboxamide\n    * N-[6-(3,5-dicyclopropyl-1H-pyrazol-1-yl)pyridin-3-yl]-3,5-dimethylisoxazole-4-carboxamide\n    * 6-(3,5-dicyclopropyl-1H-pyrazol-1-yl)-N-o-tolylnicotinamide\n    * N-[6-(3,5-dicyclopropyl-1H-pyrazol-1-yl)pyridin-3-yl]-2-fluorobenzamide\n    * N-[6-(3,5-dicyclopropyl-1H-pyrazol-1-yl)pyridin-3-yl]-2,3-difluorobenzamide hydrochloride\n    * N-[6-(3,5-dicyclopropyl-1H-pyrazol-1-yl)pyridin-3-yl]-2,6-difluorobenzamide hydrochloride\n    * N-[6-(3,5-dicyclopropyl-1H-pyrazol-1-yl)pyridin-3-yl]nicotinamide dihydrochloride\n    * N-[6-(3,5-dicyclopropyl-1H-pyrazol-1-yl)pyridin-3-yl]isonicotinamide dihydrochloride\n    * N-[6-(3,5-dicyclopropyl-1H-pyrazol-1-yl)pyridin-3-yl]-3-fluoroisonicotinamide\n    * 3,5-dichloro-N-{4-[5-cyclopropyl-3-(trifluoromethyl)-1H-pyrazol-1-yl]phenyl}isonicotinamide\n    * 3,5-dichloro-N-[6-(3,5-dicyclopropyl-1H-pyrazol-1-yl)pyridin-3-yl]isonicotinamide hydrochloride\n    *...    1
RELATED APPLICATIONS \n\nThis application is a national stage application (under 35 U.S.C. §371) of PCT/EP2010/065180, filed Oct. 11, 2010 which claims benefit of European Application No. 09014070.8, filed Nov. 10, 2009. \n\nFIELD OF THE INVENTION \n\nThe invention relates to the field of health-promoting products and preparation methods thereof. \n\nBACKGROUND OF THE INVENTION \n\nStreptococcus mutans  plays a pivotal role in the development of caries. The bacterium converts fermentable sugars into organic acids and thus generates an acidic microenvironment. The organic acids are capable of demineralizing the dental enamel and thus bring about, or promote, the cariotic lesions. Moreover, S. mutans generates a non-water-soluble glucan matrix. This glucan matrix supports the development and adhesion of plaque and the adhesion of S. mutans at the surface of the teeth. Furthermore, it has been shown that other bacteria, too, are frequently found in carotic lesions, but always together with S. mutans. Accordingly, S. mutans is currently considered to be necessary for the development of cariotic lesions.\n\nThere is a constant need for remedies with which the development of cariotic lesions can be prevented. In this context, the invention intends to indicate remedies with which it is possible to act on  S. mutans in order to avoid, stop or slow down the development of cariotic lesions. The invention also intends to indicate preparation methods for such remedies.\n\nIn the past, an entire series of remedies have been tested for controlling cariotic lesions, in particular in order to avoid or at least delay the appearance thereof. A person skilled in the art is familiar in particular with traditional chemical remedies for controlling caries and caries-associated microorganisms, as they are used in toothpastes and/or mouthwashes and/or other dental care products. In addition, however, it has also been attempted to control caries-associated microorganisms by means of other microorganisms or their products, in particular it has been attempted to reduce their amounts on teeth or in the oral cavity, or otherwise to influence the cariogenicity. Such an approach is described for example in WO 2005/027265 A1. However, the disadvantage is that the use of live microorganisms in oral care products is frequently disliked by consumers or entirely banned by legislators. Moreover, live microorganisms may influence the taste and/or the appearance of a product containing them as the result of metabolites; this influence may not be desired for every product for controlling cariotic lesions. Furthermore, the use of live organisms in products designed for controlling cariotic lesions limits the shelf-life of said products. \n\nIt is therefore quite generally attempted in various technical fields to use metabolically inactive microorganisms, in particular lyophilized microorganisms, instead of live microorganisms. The problem here, however, is that such microorganisms may, under conditions which are suitable for them, return to the metabolically active state, for example when they get into an aqueous medium which suits them. Accordingly, the use of metabolically inactive microorganisms entails serious limitations of the possible composition of a product containing them. \n\nIt has therefore been attempted in quite different technical fields to prepare products with destroyed microorganisms instead of live or metabolically active microorganisms. Thus, for example, WO 01/95741 A1 shows a foodstuff for promoting the intestinal balance, the food product containing nonviable Lactobacilli. The Lactobacilli can be made nonviable by means of heat treatment, for example by means of pasteurization or sterilization. Said document, however, also mentions the risk of losing, as a result of the heat treatment, some health-promoting effects of microorganisms which can otherwise be achieved. While the document says that these health-promoting effects can be eliminated “selectively”, the document does, in fact, not teach anything about how the loss of a desired health-promoting feature might be avoided during the heat treatment of microorganisms. In the light of said document, therefore, a person skilled in the art can neither predict nor speculate in a meaningful manner as to which health-promoting effects are lost as a result of a heat treatment of microorganisms and which are not. In particular, it cannot be predicted or estimated whether an anticariogenic effect is lost as a result of heat treatment. \n\nIt is therefore the object of the present invention to indicate remedies for controlling cariotic lesions, in particular remedies for avoiding or delaying the development of cariotic lesions. In particular, it is intended that the remedies are guaranteed to bring about the desired effect. It is intended that their preparation be simple and inexpensive and that, if possible, the above-described disadvantages be avoided or reduced to a minor extent. \n\nSUMMARY OF THE INVENTION \n\nAccording to the invention, therefore, there is indicated a method of producing a nonlive  Lactobacillus preparation with specific binding ability for Streptococcus mutans, comprising the following steps:\n\ni) warming a suspension of cells of a  Lactobacillus or a mixture of Lactobacilli with specific binding ability to Streptococcus mutans, where the specific binding\n\na) is resistant to heat treatment and/or \n\nb) is resistant to protease treatment and/or \n\nc) is calcium-dependent and/or \n\nd) takes place in a pH range of between 4.5 and 8.5 and/or \n\ne) takes place in the presence of saliva, \n\nfrom a starting temperature of below 40° C. to a pasteurization temperature of 75 to 85° C. with a temperature change of 0.5 to 2° C./min, \n\nii) holding the warm suspension at the pasteurization temperature over a period of from 20 to 40 min, \n\niii) cooling the suspension held in step ii) to a final temperature of below 40° C., with a temperature change of 0.5 to 2° C./min. \n\nSuch Lactobacilli are disclosed in WO 2006/027265 A1, which is herein incorporated by reference in its entirety for the purposes of the disclosure of the present invention. \n\nDETAILED DESCRIPTION OF THE INVENTION \n\nSurprisingly, it has emerged that a preparation which is entirely or essentially free from live, metabolically active Lactobacilli microorganisms while still having a specific binding ability for  Streptococcus mutans can successfully be prepared by the Lactobacilli selected in accordance with the invention by means of pasteurization under mild conditions as described in the steps of the method according to the invention. A preparation prepared in accordance with the invention is therefore suitable for exerting an anticariogenic effect and, accordingly, useful as a remedy for preventing and/or treating caries. The terms “caries” and “cariotic lesion” are used interchangeably within the scope of the present document and refer to a chronic infectious disease which is distinguished by the development of softened patches on or in a tooth and which progressively leads to the death of the tooth. Caries can be diagnosed by known methods; a person skilled in the art can for this purpose refer to, for example, the paper by Angmar-Mansson and ten Bosch, Adv. Dent. Res. 7 (1993), 70 to 79.\n\nFor the purposes of the present invention, the term “controlling caries” or “controlling cariotic lesions” includes the prophylaxis of caries. Therefore, persons whose oral cavity should be free from  S. mutans can therefore also benefit from other compositions which are prepared in accordance with the invention in as far as these compositions bind randomly introduced S. mutans cells and in this manner facilitate the removal of the latter.\n\nFor the purposes of the present invention, the term “treatment of caries” also includes the administration of the compositions prepared in accordance with the invention to a patient suffering from caries for the purposes of reducing the amount of  S. mutans cells and, if appropriate, for the complete elimination of S. mutans from the mouth, in particular from the entire oral cavity including the teeth and the interdental spaces.\n\nAs regards the ability to bind  S. mutans, the microorganisms selected in accordance with the invention are highly heat-stable. This allows to maintain the health-promoting effect of binding to S. mutans, which has been described in WO 2006/027265 A1 for live Lactobacillus cells, even after the pasteurization according to the invention, as opposed to, say, losing it. This is particularly uncommon since it would have been expected in principle for microorganisms that a considerable amount of, for example, their proteins would be denatured and other cell constituents dissolved or damaged upon pasteurization so that health-promoting effects of microorganisms are usually lost after pasteurization. Indeed, the abovementioned WO 01/95741 A1 merely shows that it is possible for certain Lactobacilli to maintain a health-promoting effect on the gut flora despite pasteurization. However, in terms of structure, content and use, the oral cavity is entirely different to the gut, so that a person skilled in the art could not have applied the findings of the last-mentioned documents to the present invention.\n\nIn accordance with a further aspect of the invention, accordingly, there is indicated a  Lactobacillus composition with specific binding ability for Streptococcus mutans, which composition is obtainable or obtained by a preparation process according to the invention. Such a composition realizes the above-described advantages of the preparation process according to the invention, in particular it is suitable for preparing an anticariogenic product for use in the human body.\n\nThe  Lactobacillus cells are preferably selected from among cells of strains of Lactobacillus paracasei, Lactobacillus rhamnosus or a mixture of these. The preparation process according to the invention can thus be carried out with a suspension of a pure culture of a Lactobacillus strain, in particular a strain of Lactobacillus paracasei or Lactobacillus rhamnosus, but also with a mixture of two, three, four, five, six, seven or more strains. Especially preferred for the process according to the invention are the Lactobacillus species and strains specified in WO 2006/027265 A1, in particular those with one of the DSMZ numbers DSMZ 16667, DSMZ 16668, DSMZ 16669, DSMZ 16670, DSMZ 16671, DSMZ 16672 and DSMZ 16673, in each case deposited on 26 Aug. 2004 at the Deutsche Sammlung für Mikroorganismen und Zellkulturen, Mascheroder Weg 1b, Brunswick, Germany. In as far as Lactobacillus cells are mentioned within the scope of the present invention, this is at least preferably also understood as meaning cells of the just-mentioned strains and mixtures of two, three, four, five, six or seven of the abovementioned strains. A person skilled in the art understands that, instead of, or additionally to, cells of one of the abovementioned strains, it is also possible to employ a mutant or a derived cell line in the method according to the invention, the mutant or derived cell line having retained the ability of specifically binding to S. mutans. \n\nThe  Lactobacillus cells preferably have a specific binding ability for Streptococcus mutans Serotype c (DSMZ 20523) and/or Serotype e (NCTC 10923) and/or Serotype F (NCTC 11060).\n\nA mutant, in particular a mutant of one of the abovementioned  Lactobacillus strains, has one or more permanently inheritable modifications, usually its nucleic acid(s). Such modifications usually also encompass point mutations such as transitions or transversions, but also deletions, insertions and additions of one or more bases of a nucleic acid, whereby the nucleic acid is modified and a gene expression and/or transcription and/or translation, or inactivation, of gene products which deviates from what is normal is caused. Mutations can occur spontaneously or else be triggered by the action of agents such as, for example, chemicals or irradiation. Methods of selecting and obtaining mutants and derived cell lines are described, for example, in Sambrook, “Molecular cloning, a laboratory manual”, Cold Spring Harbor Laboratory, NY, (2001) and in Ausubel, “Current protocols in molecular biology”, Green Publishing Associates and Wiley Interscience NY, (1989). The skilled worker can find further information in WO 2006/027265 A1.\n\nFor the purposes of the present invention, “specific binding” or “specific binding ability” means for  Streptococcus mutans that the Lactobacillus cells used in accordance with the invention, or the cells which have been pasteurized in accordance with the invention, bind to S. mutans, but do not bind to most, or all of, the remaining microorganisms which usually occur in the oral cavity in substantial amounts. The microorganisms selected in accordance with the invention preferably do not bind to cells of Streptococcus salivarius, Streptococcus salivarius thermophilus, Streptococcus oralis, Streptococcus mitis and/or Streptococcus sanguinis. The Lactobacillus cells used in accordance with the invention especially preferably do not bind to Streptococcus salivarius ssp. thermophilus API 50 CH (Biomerieux, France), Streptococcus oralis DSMZ 20066, Streptococcus oralis DSMZ 20395, Streptococcus oralis DSMZ 20627, Streptococcus mitis DSMZ 12643 and/or Streptococcus sanguinis DSMZ 20667. It is likewise preferred when the Lactobacillus cells used in accordance with the invention do not bind to bacteria of genera other than Streptococcus, that is to say for example not to cells of the genus Staphylococcus. Especially preferably, they do not bind to Staphylococcus epidermidis DSMZ 1798 and/or Staphylococcus epidermidis DSMZ 20044. To test the binding ability, the skilled worker proceeds as described in WO 2006/027265 A1 by mixing the abovementioned bacteria with the Lactobacilli selected in accordance with the invention, or their remainders which have been pasteurized in accordance with the invention, in a volumetric ratio of 3:1 and observing any aggregation caused by Lactobacillus. A suitable method is described in the abovementioned WO specification in example 3.\n\nAccordingly preferred is a method according to the invention in which cells of one or more of the preferred  Lactobacillus strains, in particular L. paracasei or L. rhamnosus and preferably one or more of strains DSMZ 16667, DSMZ 16668, DSMZ 16669, DSMZ 16670, DSMZ 16671, DSMZ 16672 and DSMZ 16673 and especially preferably at least DSM 16671 and/or one mutant or derived cell line as described above are, in a first step, warmed in a suspension from a starting temperature of below 40° C. to a pasteurization temperature of from 75 to 85° C. with a temperature change from 0.5 to 2° C., are held, in a second step, at the pasteurization temperature for 20 to 40 min (pasteurization time) and in which the suspension, in a subsequent third step, is cooled to a final temperature of below 40° C. with a temperature change of from 0.5 to 2° C.\n\nThe pasteurization temperature in step i) is preferably 78 to 80° C., especially preferably 80° C. With such pasteurization temperatures, a rapid and, accordingly, energy-saving, yet secure, destruction of the  Lactobacillus cells selected in accordance with the invention is successfully effected while simultaneously losing little binding ability in comparison with a nonpasteurized culture of live Lactobacillus cells.\n\nThe pasteurization time is preferably 25 to 35 min and especially preferably 30 min. It has emerged that in particular with a pasteurization temperature of 78 to 80° C. (preferably 80° C.), a rapid destruction of the  Lactobacillus cells selected in accordance with the invention combined with a minor loss of S. mutans binding ability is possible in comparison with a live culture of the Lactobacillus cells.\n\nIt is likewise preferred when the temperature change in step i) or iii) is 0.8 to 1.2° C. per min, preferably 1° C. per min. In this manner, the heating-up time up to reaching the pasteurization temperature can be kept advantageously short so that energy can be saved, without thereby risking the destruction of the  Lactobacillus cells or having to accept a great loss of binding ability for S. mutans. \n\nEspecially preferred is also a method according to the invention in which cells of one or more of the preferred  Lactobacillus strains, in particular L. paracasei or L. rhamnosus and preferably one or more of strains DSMZ 16667, DSMZ 16668, DSMZ 16669, DSMZ 16670, DSMZ 16671, DSMZ 16672 and DSMZ 16673 and especially preferably at least DSM 16671 and/or one mutant or derived cell line as described above are, in a first step, warmed in a suspension from a starting temperature of below 40° C. to a pasteurization temperature of from 78 to 80° C., preferably 80° C., with a temperature change from 0.8 to 1.2° C., preferably 1° C., are held, in a second step, at the pasteurization temperature for 25 to 35 min and preferably 30 min (pasteurization time) and in which the suspension, in a subsequent third step, is cooled to a final temperature of below 40° C. with a temperature change of from 0.8 to 1.2° C., preferably 1° C.\n\nThe cells pasteurized in accordance with the invention are preferably in a post-exponential growth phase. It is especially preferred to use, in step i) of the preparation method according to the invention, cells from a culture medium which initially had allowed exponential growth, in which, however, the glucose concentration has dropped to a value of not more than 1 mM glucose. Here, it is preferred to use cells whose glucose concentration has dropped to a value of not more than 1 mM glucose for not more than 1 h, since otherwise the ability, of specifically binding to  Streptococcus mutans, of the product of the preparation method according to the invention, i.e. of the result of step iii), if appropriate of the wash step or the spray-drying as described hereinbelow begins to be lost.\n\nThe method according to the invention furthermore preferably comprises a wash step in which the suspension obtained in step (iii) is centrifuged in order to concentrate the pasteurized cells, the concentrated cells thus obtained are treated with water and recentrifuged in order to reconcentrate the cells. The concentrated cells obtained are present as a substance with a dry-matter content of 10 to 30% by weight of the substance, preferably from 18 to 22% by weight. \n\nEspecially preferred in accordance with the invention is such a method which, besides steps i) to iii) (in particular applied to one, or a mixture of two, three, four, five, six or seven, of the  Lactobacillus strains DSM 16667, DSM 16668, DSM 16669, DSM 16670, DSM 16671, DSM 16672 and DSM 16673 or of a mutant or cell line described hereinabove or of a strain of L. paracasei or L. rhamnosus) and, if appropriate, washing, comprises the following steps:\n\niv) treating the suspension obtained in step iii), preferably washed, with a carrier for preparing a spray-drying mixture, the carrier being selected from among alkali metal sulfates and alkaline-earth metal sulfates, preferably sodium sulfate, potassium sulfate or calcium sulfate, and mixtures of two or more of these sulfates, the amount of carrier being chosen such that the dry-matter content of the spray-drying mixture amounts to 10 to 30% by weight, and \n\nv) spray-drying of the spray-drying mixture obtained in step iv). \n\nSpray-drying exposes the material to be dried to very harsh conditions and in particular to temperatures of, for example, 70° C. to 200° C. It was not known even from the  Lactobacillus cells selected in accordance with the invention if they withstand the harsh conditions which occur during spray-drying without a significant loss of specific binding ability for S. mutans. What is more, with high amounts in accordance with the invention of carrier in step iv), it would have been expected that the surface structures of Lactobacillus, which are responsible for further binding to S. mutans, would be denatured or otherwise damaged. Surprisingly, it has now emerged that spray-drying of the suspension obtained in step iii) under the selected conditions is possible without a substantial loss of binding ability for S. mutans. \n\nSome advantages of the spray-drying method according to the invention and of the spray-dried composition according to the invention prepared thus are particularly worthy of attention: in contrast to simple pasteurization, the spray-drying according to the invention allows a non tacky or hygroscopic composition to be obtained. In this context, hygroscopic means that open storage over a period of 12 months at a temperature of 20° C. and a relative humidity of 60%, the weight of the composition increased by no more than 2%. The composition according to the invention prepared thus is therefore particularly suitable for processing in dry products; it will not adversely affect the properties of these products as a result of attracting water or of being especially tacky. \n\nThe preparation method according to the invention furthermore makes it possible to prepare a composition according to the invention which is free-flowing. Particulate, free-flowing compositions can be stored and processed with particular ease, and they can be incorporated into a very wide range of products while being able to be dosed very precisely. Compositions according to the invention obtained by the spray-drying method according to the invention can thus be incorporated into a much wider product spectrum on an economically important scale than the suspension obtained directly after step iii). \n\nEspecially preferred as the carrier in step iv) is sodium sulfate. The amount of carrier, especially preferably of sodium sulfate, preferably amounts to times the dry matter of the suspension employed from step iii). The spray-drying mixture employed for spray-drying in step v) will in this case contain approximately 20% by weight of total dry-matter. \n\nSpray-drying is effected in step v), preferably at a gas inlet temperature of a spray-drying gas employed for drying of from 180 to 250° C. and a gas outlet temperature from the zone provided for drying, usually a spray tower, of from 70 to 100° C., preferably 85° C., the average residence time in the reaction zone of the spray-drying gas of the material to be dried being from 10 to 60 seconds, preferably from 20 to 40 seconds. A person skilled in the art can furthermore take guidance on spray-drying from the information provided in WO 01/25411 A1. This document describes generally suitable spray-drying methods for the preparation of spray-dried enzyme products. Surprisingly, it has now emerged that spray-drying without substantial loss of binding ability for  S. mutans is possible even at the higher temperatures which are preferred in accordance with the invention. This could not have been expected on the basis of WO 01/25411 A1, in particular because said document does not describe a single example of a working spray-drying step following pasteurization and since a person skilled in the art would consider the document to be speculative as regards the suitability of spray-drying for an allegedly very wide class of enzymes.\n\nTherefore, a method according to the invention which is especially preferred is one in which: \n\n(i) cells of one or more of the preferred  Lactobacillus strains, in particular L. paracasei or L. rhamnosus and preferably one or more of strains DSMZ 16667, DSMZ 16668, DSMZ 16669, DSMZ 16670, DSMZ 16671, DSMZ 16672 and DSMZ 16673 and especially preferably at least DSM 16671 and/or one mutant or derived cell line in a post-exponential growth phase as described above are, in a first step, warmed in a suspension from a starting temperature of below 40° C. to a pasteurization temperature of from 78 to 80° C., preferably 80° C., with a temperature change from 0.8 to 1.2° C., preferably 1° C., and, subsequently,\n\n(ii) the suspension is held for 25 to 35 min and preferably for 30 min at the pasteurization temperature, and, subsequently, \n\n(iii) the suspension is cooled to a final temperature of below 40° C. with a temperature change of 0.8 to 1.2° C., preferably 1° C., is subsequently washed with water as described above and brought to a dry-matter content of from 10 to 30% by weight, preferably from 18 to 22% by weight, by centrifugation, and, subsequently, \n\n(iv) the suspension is treated with a carrier for preparing a spray-drying mixture, the carrier being selected from among sodium sulfate, potassium sulfate and calcium sulfate and mixtures of two or more of these and especially preferably sodium sulfate, the amount of carrier being chosen such that the dry-matter content of the spray-drying mixture amounts to from 10 to 30% by weight, and, subsequently, \n\n(v) the carrier-containing suspension obtained in step (iv) is spray-dried at a gas inlet temperature of a spray-drying gas employed for drying of from 180 to 250° C. and a gas outlet temperature from the zone provided for drying, usually a spray tower, of from 70 to 100° C., preferably 85° C., the average residence time in the reaction zone of the spray-drying gas of the material to be dried being from 10 to 60 seconds, preferably from 20 to 40 seconds. \n\nThis method realizes the above-described advantages of the invention. \n\nThe  Lactobacillus composition according to the invention with a specific binding ability for Streptococcus mutans, which composition is obtainable obtained by a method with steps i) to iii) and optionally iv) to v) is preferably incorporated into a product for use in the human body. When used for the human body, in particular by introducing into the oral cavity and/or by bringing into contact with teeth, it is indeed possible to carry out a caries prophylaxis using the compositions according to the invention.\n\nThe products according to the invention expediently comprise the composition according to the invention in an amount which suffices for binding to  S. mutans and/or for obtaining an anticariogenic effect. This amount depends on the nature of the product in question and on its pharmaceutical presentation. In particular, the amount also depends on the specifically desired extent of the possible binding to S. mutans or of the possible anticariogenic effect. Depending on the product, a person skilled in the art will, by means of routine experiments, readily determine the amount of composition according to the invention which suffices with regard to the desired extent of the effect, the nature of the product and the pharmaceutical presentation. In particular, a person skilled in the art will take into consideration that a product can be coated with the composition according to the invention or can have this composition incorporated by admixing.\n\nA product according to the invention is preferably selected from the group consisting of food products, including luxury food products, beverage products, semifinished products, oral hygiene products, cosmetic products and pharmaceutical products. Corresponding products are described in WO 2006/027265 A1. \n\nEspecially preferred products are chewing gum, toothpaste, oral rinses and lozenges. \n\nThe invention is hereinbelow described with reference to the examples, but the examples are not intended to limit the scope of protection of the claims. \n\nExample 1 \n\nGeneral Preparation Process \n\nLactobacillus  cells with a specific binding ability to Streptococcus mutans, were the specific binding\n\na) is resistant to heat treatment and/or \n\nb) is resistant to protease treatment and/or \n\nc) is calcium-dependent and/or \n\nd) takes place in a pH range of between 4.5 and 8.5 and/or \n\ne) takes place in the presence of saliva, \n\nare cultured in a suitable aqueous nutrient medium at 37° C. A suitable nutrient medium contains glucose, yeast extract, Tween 80 and salts. Culturing is done as an aqueous suspension in a fed-batch operation. \n\nAs soon as the glucose content of the nutrient medium has dropped below 1 mM, or up to 1 hour after this point in time, the suspension is warmed to a pasteurization temperature of from 75 to 85° C., preferably from 78 to 80° C. In this context, the suspension is warmed with a temperature change of from 0.5 to 1.2° C./min, preferably from 0.8 to 1.2° C./min. \n\nThe warm suspension is held at the pasteurization temperature for 20 to 40 minutes, preferably 25 to 35 minutes and especially preferably 30 minutes. \n\nThe suspension is subsequently cooled to below 40° C. In this context, the temperature change amounts to from 0.5 to 2° C./min, preferably from 0.8 to 1.2° C./min. \n\nThe cool suspension subsequently concentrated to a dry-matter content of from 10 to 30% by weight by means of centrifugation. The concentrate thus obtained is resuspended in water and again concentrated to a dry-matter content of from 10 to 30% by weight by means of centrifugation. Resuspending and concentrating is carried out up to 8 times in total. At the end, a washed biomass with a dry-matter content of from 10 to 30% by weight is obtained. \n\nThis biomass still retains the ability of specifically binding to  Streptococcus mutans, as described at the outset in the example. The biomass per se can be incorporated into foodstuffs, including luxury foodstuffs, beverages, semifinished products, oral hygiene products, cosmetic products or pharmaceutical products in order to equip the product for controlling caries or in order to support its already preexisting ability to control caries.\n\nExample 2 \n\nPreparation of an Oral Care Composition \n\nA culture of  L. paracasei or L. rhamnosus with the specific binding ability to Streptococcus mutans which has been defined in accordance with the invention is cultured, pasteurized and washed as described in example 1. The pasteurization temperature is 0° C. The pasteurization time is 30 min. The temperature change is in each case from 0.8 to 1.2° C./min. The concentrated suspension obtained after the first centrifugation is resuspended to a dry-matter content of 5% by weight of the resuspension by adding water. The resuspension thus obtained is recentrifuged down to a dry-matter content of 20% by weight.\n\nThe washed and concentrated biomass thus obtained is treated with an aqueous carrier and flavorings. This gives an oral rinse for controlling caries. \n\nIn the same manner, washed and concentrated biomass prepared with DSMZ 16667, DSMZ 16668, DSMZ 16669, DSMZ 16670, DSMZ 16671, DSMZ 16672 or DSMZ 16673 is obtained. This biomass is in each case likewise treated with an aqueous carrier and with flavorings in order to obtain in each case an oral rinse for controlling caries. \n\nChewing gums, toothpastes and lozenges for controlling caries are produced instead of an oral rinse by incorporating the respective washed and concentrated biomass into chewing gum base, toothpaste base and lozenge base and adding desired flavorings. \n\nExample 3 \n\nGeneral Spray-Drying Method \n\nA basic spray-drying solution is prepared by preparing an aqueous, 10 to 30% strength alkali and/or alkaline-earth sulfate solution. The washed and concentrated biomass obtained as described in example 1 is resuspended in the four-fold quantity of the basic spray-drying solution for forming a spray-drying mixture, so that 500 units of volume of spray-drying mixture are obtained from 100 units of volume of the biomass. \n\nThe spray-drying mixture is spray-dried by introducing into a spray-drying tower. The...    1
RELATED APPLICATIONS \n\nThis application is a National Stage of International Application PCT/EP2010/007805, filed Dec. 20, 2010, which claims the benefit of the filing date under 35 U.S.C. §119(e) of Provisional U.S. Patent Application Ser. No. 61/288,697, filed Dec. 21, 2009. Both applications are hereby incorporated by reference in their entirety. \n\nBRIEF DESCRIPTION OF THE DRAWINGS \n\nFIG. 1  depicts a TIC Chromatogram of the reaction product of n-butyl lithium with N-methylpyrrolidinone (E1).\n\nFIG. 2  depicts a Mass Spectrum of peak at 9.01 min (product D1).\n\nFIG. 3 : depicts the preparative GPC profile of product D2.\n\nFIG. 4  depicts the Mass Spectrum of peak at 15.62 min (product D2).\n\nFIG. 5  depicts the Mass Spectrum (exact mass) of product D2, isolated using preparative GPC\n\nFIG. 6  depicts the Mass Spectrum (exact mass) of product D1, isolated using preparative GPC.\n\nFIG. 7  depicts the 13C-NMR (200 MHz, 23° C., CDCl3) profile of compound D2.\n\nFIG. 8  depicts the 2D INADEQUATE profile of compound D2.\n\nFIG. 9  depicts the 1H-NMR NMR Simulation of compound D1.\n\nFIG. 10  depicts the 13C-NMR-Simulation of compound D1.\n\nFIG. 11  depicts the 1H-NMR (200 MHz, 24° C., CDCl3) measuring results of compound D1.\n\nFIG. 12  depicts the 13C-NMR (200 MHz, 24° C., CDCl3) measuring results of compound D1.\n\nFIG. 13  depicts the TIC Chromatogram of reaction product of sec-butyl lithium with N-methylpyrrolidinone (E1).\n\nFIG. 14  depicts the Mass Spectrum of compound D1b; GC signal at 6.5 min.\n\nFIG. 15  depicts the Mass Spectrum of compound D2; GC signal at 13.9 min.\n\nFIG. 16  depicts the 13C-NMR (200 MHz, 23° C., CDCl3) of D2 containing E1 modified polybutadiene (above) and of D2 (below).\n\nFIELD OF THE INVENTION \n\nThis invention relates to modified polymer compositions comprising alpha modified/omega modified polymers and alpha modified/branched modified polymers, each as described herein. The invention also relates to the use of these compositions in the preparation of vulcanized compositions, and articles prepared from the same. The modified compositions are useful in the preparation of vulcanized, and thus cross-linked, elastomeric compositions having relatively low hysteresis loss. Such compositions are useful in many articles, including tire treads having low rolling resistance, good wet grip and ice grip, in combination with a good balance of other desirable physical and chemical properties, for example, abrasion resistance, tensile strength and processability. \n\nBACKGROUND OF THE INVENTION \n\nIt is generally accepted, that increasing oil prices and national countries' legislations that require the reduction of automotive carbon dioxide emissions, force tire and rubber producers to contribute to produce “fuel efficient,” and thus fuel or gas saving tires. One general approach to obtain fuel efficient tires is to produce tire formulations that have reduced hysteresis loss. A major source of hysteresis in vulcanized elastomeric polymers is believed to be attributed to free polymer chain ends, that is, the section of the elastomeric polymer chain between the last cross-link and the end of the polymer chain. This free end of the polymer does not participate in any efficient elastically recoverable process, and as a result, any energy transmitted to this section of the polymer is lost. This dissipated energy leads to a pronounced hysteresis under dynamic deformation. Another source of hysteresis in vulcanized elastomeric polymers is believed to be attributed to an insufficient distribution of filler particles in the vulcanized elastomeric polymer composition. The hysteresis loss of a cross-linked elastomeric polymer composition is related to its Tan ?, at 60° C., value (see ISO 4664-1:2005; Rubber, Vulcanized or thermoplastic; Determination of dynamic properties—part 1: General guidance). In general, vulcanized elastomeric polymer compositions having relatively small Tan ? values, at 60° C., are preferred as having lower hysteresis loss. In the final tire product, this translates to a lower rolling resistance and better fuel economy. \n\nIt is generally accepted, that a lower rolling resistance tire can be made on the expense of deteriorated wet grip properties. For example, if, in a random solution styrene-butadiene rubber (random SSBR), the polystyrene unit concentration is relatively reduced, with respect to the total polybutadiene unit concentration, and the 1,2-polydiene unit concentration is kept constant, both the tan delta at 60° C. and the tan delta at 0° C., are reduced, generally corresponding to improved rolling resistance and deteriorated wet grip performance of a tire. Similarly, if, in a random solution styrene-butadiene rubber (random SSBR), the 1,2-polybutadiene unit concentration is relatively reduced, with respect to the total polybutadiene unit concentration, and the polystyrene unit concentration is kept constant, both the tan delta at 60° C. and the tan delta at 0° C. are reduced, generally corresponding to improved rolling resistance and deteriorated wet grip performance of a tire. Accordingly, when assessing the rubber vulcanizate performance correctly, both the rolling resistance, related tan delta at 60° C., and the wet grip, related tan delta at 0° C., should be monitored. \n\nOne generally accepted approach to reducing hysteresis loss is to reduce the number of free chain ends of elastomeric polymers. Various techniques are described in the open literature including the use of “coupling agents,” such as tin tetrachloride, which may functionalize the polymer chain end, and react with components of an elastomeric composition, such as, for example, with a filler or with unsaturated portions of a polymer. Examples of such techniques, along with other documents of interest, are described in the following patents: U.S. Pat. Nos. 3,281,383; 3,244,664 and 3,692,874 (for example, tetrachlorosilane); U.S. Pat. No. 3,978,103; U.S. Pat. Nos. 4,048,206; 4,474,908; U.S. Pat. No. 6,777,569 (blocked mercaptosilanes) and U.S. Pat. No. 3,078,254 (a multi-halogen-substituted hydrocarbon, such as 1,3,5-tri(bromo methyl)benzene); U.S. Pat. No. 4,616,069 (tin compound and organic amino or amine compound); and U.S. 2005/0124740. \n\nThe application of “coupling agents,” as reactant to living polymers, more often than not, leads to the formation of polymer blends comprising one fraction of linear or uncoupled polymers, and one or more fractions comprising more than two polymer arms at the coupling point. The reference “Synthesis of end-functionalized polymer by means of living anionic polymerization,” Journal of Macromolecular Chemistry and Physics, 197, (1996), 3135-3148, describes the synthesis of “polystyrene-containing” and “polyisoprene-containing” living polymers with hydroxy (—OH) and mercapto (—SH) functional end caps, obtained by reaction of the living polymers with haloalkanes containing silyl ether and silyl thioether functions. The tertiary-butyldimethylsilyl (TBDMS) group is preferred as a protecting group for the —OH and —SH functions in the termination reactions, because the corresponding silyl ethers and thioethers are found to be both, stable and compatible with anionic living polymers. \n\nInternational Publication No. WO2007/047943 describes the use of a silane-sulfide omega chain end modifier, represented by the formula (RO) x(R)ySi—R?—S—SiR3, wherein x is the number one, two or three, y is the number zero, one or two, the sum of x and y is three, R is alkyl, and R? is aryl, alkylaryl or alkyl, to produce a chain end modified elastomeric polymer, used as component in a vulcanized elastomeric polymer composition, or in a tire tread.\n\nMore specifically, according to WO2007/047943, a silane-sulfide compound is reacted with anionically-initiated, living polymers to produce “chain end modified” polymers, which are subsequently blended with fillers, vulcanizing agents, accelerators or oil extenders, to produce a vulcanized elastomeric polymer composition having low hysteresis loss. To further control polymer molecular weight and polymer properties, a coupling agent (or linking agent) can be used according to WO 2007/047943, as an optional component, in the process of the preparation of elastomeric polymers. The modifier is than added before, after, or during, the addition of a coupling agent, and preferably, the modification reaction is completed after the addition of the coupling agent. In some embodiments, more than a third of the polymer chain ends are reacted with a coupling agent prior to addition of the modifier. \n\nU.S. Pat. No. 5,502,131 describes a method of preparing a polymer comprising polymerizing diolefin monomers and/or monovinylaromatic monomers in the presence of a polymerization initiator having the general Formula A or B: \n\nwherein R? 1 and R?2 are same or different and are selected from alkyls, cycloalkyls or aralkyls, R?3 is a deprotonated allyl, 2-methallyl and xylyl, R?4 is a carbocyclic group, and R?5 is an alkyl substituent on a methylene group. The formation of polymers comprising polar groups in the alpha and omega chain end positions was not conclusively demonstrated in the experimental section of the U.S. Pat. No. 5,502,131. Tan delta at 0° C. values correlating with the tire wet grip performance was not reported at all. Furthermore, the impact of the presented alpha chain end modified polymers in silica compound vulcanizates was not demonstrated or stated in the patent application. In addition, no heteroatom is included in R?4 in Formula B, and aromatic substituents are excluded for R?1 and R?2 in Formula A.\n\nGerman Democratic Republic (GDR) patent applications DD 237513 A1, DD 242232 A1 and DD 236321 A1 describe a procedure for the preparation of multi-functional 1,3-diene homo- and copolymers (e.g. of butadiene with isoprene, styrene or alpha-methylstryrene), based on polymerization initiators of the general formula: \n\nwherein n is a number from 2 to 6, R, R?, R? and R?? are each independently selected (but depending on the specific patent application DD 237513 A1, DD 242232 A1 or DD 236321 A1 selected) from the group consisting of alkyl, cyclic alkyl, aryl, allyl, deprotonated allyl or R??—(CH 2—CH(Li)—CH2)—, wherein and R?? is an alkyl group, a cycloalkyl group or an aryl group. The molecular weights of the polymers as described in DD 237513 A1, DD 242232 A1 and DD 236321 A1 are too low to be used for compound mixtures useful for the application in tires.\n\nInternational Publication No. WO 2009/077837 A1 refers to a butadiene-styrene copolymer, functionalized at both extremities of its chains, to the preparation of the copolymers, to compounds comprising mentioned copolymers, and to the use of the same. In particular the patent publication refers to two groups of polymers, Group 1 representing alpha omega modified linear random styrene butadiene rubber, and Group 2 representing linear, branched and/or radial copolymer structures, as depicted in Scheme 1 below. \n\nIn Scheme 1, F 1 represents a terminal functionalization of polymeric chains, and can be groups of the type —OH, —COOH, —COX, where X is a halogen, —SH, —CSSH, —NCO, epoxy and amine, and the amine group more specifically defined as one of the following structures: —N(R1)2, —NR2R2, —NHR1, NH2, wherein the groups R1 and R2 may be alkyl groups, cycloalkyl groups, aralkyl groups or aryl groups.\n\nIn Scheme 1, F 2 represents one of the extremities of the polymer chains, functionalized with silyl, silanol and siloxane groups defined as one of the following structures —SiH2(OH), —Si(R1)2(OH), —SiH(OH)2, —SiR1(OH)2, —Si(OH)3, —Si(OR1)3, —(SiR1R2O)x-R3, —Si(R3)3-m(X)m, wherein X is a halogen, R1 and R2 are alkoxy, alkyl, cycloalkyl, aralkyl or vinyl groups, and R3 is hydrogen, alkyl, aryl or an amine group containing siloxane group represented by the formula -A1-Si(A2-N((H)k(R1)2?k))y(OR1)z(R3)3?(y+z), where k is the number 0, 1 or 2, y is the number 1, 2 or 3, z is the number 0, 1 or 2, 0?y+z?3, and R1, R2, R3, A1 and A2 are groups containing exclusively hydrogen and carbon atoms.\n\nIn Scheme 1, C is a silicon or tin based coupling agent with a functionality greater than, or equal to, the number 2, and represented by structures wherein the silicon or tin atom of the coupling agent is linked to a halogen, an —OR group or to a group containing exclusively hydrogen and carbon atoms, stated R group also represents a hydrocarbon group. \n\nThe application claims a butadiene and styrene copolymer containing “Group 1” (linear structure) and “Group 2” (branched or radial structure) butadiene-styrene copolymers, and one or more fillers, the nature of the fillers not being defined. In the patent application, there was no indication about the performance of the described polymers in carbon black compound vulcanizates. \n\nTwo typical fillers, silica and carbon black are applied to the tire production. Standard formulations very often comprise both fillers, silica and carbon black, in different ratios. Therefore, it would be desirably to have a modified polymer which gives excellent rolling resistance, and grip characteristics, in both carbon black and silica compounds. In addition, it would be desirable to have improved heat build-up values for the modified polymer-filler vulcanizate. A decreased heat built-up value reduces the risk of depolymerization in the vulcanizate in thermal and mechanical stress situations. \n\nAdditional initiator compounds and/or modifier compounds are described in the following: U.S. Pat. No. 5,502,131, U.S. Pat. No. 6,025,450, U.S. Pat. No. 6,080,835, U.S. Pat. No. 6,046,288, U.S. Pat. No. 5,792,820, U.S. Pat. No. 5,916,961, U.S. Pat. No. 5,866,650, U.S. Pat. No. 5,959,048, U.S. Pat. No. 5,852,189, U.S. Pat. No. 5,912,343, U.S. Pat. No. 5,736,617, U.S. Pat. No. 5,786,441, U.S. Pat. No. 7,342,070, U.S. Pat. No. 6,229,036, U.S. Pat. No. 5,248,736, EP0180141, EP150479, EP0180853, International Publication Nos. WO 2007/047943, WO 2009/148932, and WO 2010/056694. \n\nThere is a need for modification methods and resulting modified polymers that can be used to further optimize dynamic silica and carbon black vulcanizate properties, including low hysteresis properties, corresponding to a high wet grip and to a low rolling resistance property in tires. In addition there is a need to further decrease the vulcanizate heat built up during thermal exposure and under mechanical stress. These needs have been met by the following invention. \n\nSUMMARY OF THE INVENTION \n\nThe invention provides a first composition comprising at least the following: \n\ni) a modified polymer comprising at least one branched modified polymer macromolecule (b1) and at least one linear modified polymer macromolecule (a1), and wherein the at least one branched modified polymer macromolecule and the at least one linear modified polymer macromolecule each, independently, comprises at least one amine group selected from the group consisting of formulas (1A-1F): \n\n\n and combinations thereof; \n\nwherein, N is a nitrogen atom, C is carbon atom, H is a hydrogen atom; \n\nE is at least divalent, and is selected from the following: a) a (C 1-C18) alkyl, which may be substituted with one or more of the following groups: amine group, R39R40R41Si— and R39R40R41Si-amine group; where R39, R40 and R41 are each independently selected from the group consisting of: (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl; (C6-C18) aryl, (C7-C18) aralkyl; b) an oxygen atom (O); c) a sulfur atom (S); d) N—CHR8—CR9?CR10, where R8, R9 and R10 are each defined below; e) N—CHR8—C?CHR10, where R8, R9 and R10 are each defined below; f) N—CR8—CR9?CHR10, where R8, R9 and R10 are each defined below; g) N—CHR8—CR9?CHR10, where R8, R9 and R10 are each defined below; h) a H—N group; or i) a R42R43R44SiN group, where R42, R43 and R44 are each independently selected from the group consisting of: (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl;\n\nR 11 and R12 are each at least divalent, and are each independently selected from the group consisting of: (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl;\n\nR 8, R9, R10 are each independently selected from the group consisting of: hydrogen (H), (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl;\n\nR 6 is selected from the group consisting of: hydrogen (H), (C1-C18) alkyl, (C6-C18) aryl, (C7-C18) aralkyl and —SiR36R37R38, where R36, R37 and R38 are each independently selected from the group consisting of: (C1-C18) alkyl (C6-C18) aryl, and (C7-C18) aralkyl; and (C1-C18) alkyl may be substituted with one or more of the following groups: amine group, R45R46R47Si group, or (R45R46R47Si)2N group, where R45, R46 and R47 are each independently selected from the group consisting of: (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl;\n\nR 7 is selected from the group consisting of: hydrogen (H), (C1-C18) alkyl, (C6-C18) aryl, (C7-C18) aralkyl, —CHR8—CR9?CHR10, and —SiR21R22R23, where R21, R22 and R23 are each independently selected from the group consisting of: (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl;\n\na is the number 1 or 2; and b is the number zero or one; and \n\nwherein the at least one branched modified polymer macromolecule further comprises ib) at least one of the following structures (ib1-ib4): \n\nib1) a four valent silicon or tin atom, each referred to as (R??) tM group, or a (R??)tM(X)p group, or a M(X)z—(O)x-M(X)z group, wherein M is a tin or a silicon atom, O is an oxygen atom, X is a halide atom, an alkoxy group or a hydroxyl group (—OH group), R?? is an (C1-C6)-alkyl group, z is the number 1 or 2, x is the number zero or 1, p is the number 1 or 2, t is the number 0, 1 or 2, and wherein, for each group, the remaining free valences on M are each linked to an alpha-modified polymer macromolecule;\n\nib2) a group according to Formula 2A:  \n(R 24O)q(R25)rSi—R29—S—Si?R26R27R28??Formula 2A,\n\nwherein, Si and Si? are silicon atoms, S is a sulfur atom and O is an oxygen atom; \n\nR 24 is selected from the group consisting of: hydrogen (H), and (C1-C6) alkyl;\n\nR 25, R26, R27 and R28 are the same or different, and are each independently selected from the group consisting of: hydrogen (H), (C1-C18) alkyl, (C1-C18) alkoxy, (C6-C18) aryl, and (C7-C18) aralkyl;\n\nR 29 is a divalent group selected from the group consisting of: a di-(C2-C20) alkylether (alkyl-O-alkyl), a (C6-C18) aryl, a (C7-C18) alkylaryl, and a (C1-C18) alkyl, and each R29 group may be substituted with at least one of the following: a (C1-C4) alkyl, a (C1-C4) alkoxy, a (C7-C16) aryl, a (C7-C16) aralkyl, a nitrile, an amine, an NO2, and/or a thioalkyl;\n\nq is the number 0 or 1; and r is the number 0 or 1; the sum of q and r (q+r) is the number 0 or 1; and the remaining free valences of the “four valent silicon atom,” Si, are each linked to an alpha-modified polymer macromolecule; \n\nib3) a group according to Formula 2B:  \n(R 24O)q(R25)rSi—R29—S—H??Formula 2B,\n\nwherein, Si is a silicon atom, S is a sulfur atom, O is an oxygen atom, H is a hydrogen atom; \n\nR 24 is selected from the group consisting of: hydrogen (H) and (C1-C6) alkyl;\n\nR 25 is selected from the group consisting of: hydrogen (H), (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl;\n\nR 29 is a divalent group selected from the group consisting of: a di-(C2-C20) alkylether (alkyl-O-alkyl), an (C6-C18) aryl, a (C7-C18) alkylaryl, and a (C1-C18) alkyl, and each R29 group may be substituted with at least one of the following: a (C1-C4) alkyl, a (C1-C4) alkoxy, a (C7-C16) aryl, a (C7-C16) aralkyl, a nitrile, an amine, a NO2, and/or a thioalkyl;\n\nq is the number 0 or 1; and r is the number 0 or 1; the sum of q and r (q+r) is the number 0 or 1; and the remaining free valences of the “four valent silicon atom,” Si, are each to linked to an alpha-modified polymer macromolecule; \n\nib4) a group according to Formula 2C:  \n(R 30O)s(R31)tSi—R35—N(H)u(Si?R32R33R34)v??Formula 2C,\n\nwherein, Si and Si? are silicon atoms, S is a sulfur atom, N is a nitrogen atom, and O is an oxygen atom; \n\nR 30 is selected from the group consisting of: hydrogen (H) and (C1-C6) alkyl;\n\nR 31, R32, R33 and R34 are the same or different, and are each independently selected from the group consisting of: hydrogen (H), (C1-C18) alkyl, (C1-C18) alkoxy, (C6-C18) aryl, and (C7-C18) aralkyl;\n\nR 35 is a divalent group selected from the group consisting of: a di-(C2-C20) alkylether (alkyl-O-alkyl), an (C6-C18) aryl, a (C7-C18) alkylaryl, and a (C1-C18) alkyl, and each R35 group may be substituted with at least one of the following: a (C1-C4) alkyl, a (C1-C4) alkoxy, a (C7-C16) aryl, a (C7-C16) aralkyl, a nitrile, an amine, an NO2, and/or a thioalkyl;\n\ns is the number 0 or 1; and t is the number 0 or 1; the sum of s and t (s+t) is the number 0 or 1; u is the number 0, 1 or 2; v is the number 0, 1 or 2; and the sum of u and v (u+v) is the number 2; and the remaining free valences of the “four valent silicon atom,” Si, are each linked to an alpha-modified polymer macromolecule; and \n\nwherein the at least one linear modified polymer macromolecule further comprises at least one the following structures (iib1): \n\niib1) a tertiary amine group according to Formula 3A: \n\nwherein C is a carbon atom, N is a nitrogen atom, H is a hydrogen atom; \n\nR 15, R16 and R17 are the same or different, and are each, independently, selected from hydrogen, alkyl, aryl or aralky; preferably selected from hydrogen, methyl, ethyl, propyl, or butyl, and more preferably hydrogen;\n\nR? is selected from alkyl, aryl or aralky; and preferably selected from methyl, ethyl, propyl, or butyl, and most preferably methyl; \n\nR 13, R14 are the same or different, and are each, independently, selected from hydrogen or alkyl, and preferably selected from hydrogen, methyl or ethyl.\n\nw is the number 0 or 1; x is the number 0 or 1; the sum of w and x is the number 1 (w+x=1).  | \n\nDETAILED DESCRIPTION OF THE INVENTION \n\nAs discussed above, the invention provides a first composition comprising at least the following: \n\ni) a modified polymer comprising at least one branched modified polymer macromolecule (b1) and at least one linear modified polymer macromolecule (a1), and wherein the at least one branched modified polymer macromolecule and the at least one linear modified polymer macromolecule each, independently, comprises at least one amine group selected from the group consisting of formulas (1A-1F): \n\n\n and combinations thereof; \n\nwherein, N is a nitrogen atom, C is carbon atom, H is a hydrogen atom; \n\nE is at least divalent, and is selected from the following: a) a (C 1-C18) alkyl, which may be substituted with one or more of the following groups: amine group, R39R40R41Si— and R39R40R41Si-amine group, where R39, R40 and R41 are each independently selected from the group consisting of: (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl; (C6-C18) aryl, (C7-C18) aralkyl; b) an oxygen atom (O); c) a sulfur atom (S); d) N—CHR8—CR9?CR10, where R8, R9 and R10 are each defined below; e) N—CHR8—C?CHR10, where R8, R9 and R10 are each defined below; f) N—CR8—CR9?CHR10, where R8, R9 and R10 are each defined below; g) N—CHR8—CR9?CHR10, where R8, R9 and R10 are each defined below; h) a H—N group; or i) a R42R43R44SiN group, where R42, R43 and R44 are each independently selected from the group consisting of: (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl;\n\nR 11 and R12 are each at least divalent, and are each independently selected from the group consisting of: (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl; and R11 and R12 are each preferably independently selected from (C1-C5) alkyl;\n\nR 8, R9, R10 are each independently selected from the group consisting of: hydrogen (H), (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl; and R8, R9 and R10 are each preferably independently selected from (C1-C5) alkyl;\n\nR 6 is selected from the group consisting of: hydrogen (H), (C1-C18) alkyl, (C6-C18) aryl, (C7-C18) aralkyl and —SiR36R37R38, where R36, R37 and R38 are each independently selected from the group consisting of: (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl; and (C1-C18) alkyl may be substituted with one or more of the following groups: amine group, R45R46R47Si group, or (R45R46R47Si)2N group, where R45, R46 and R47 are each independently selected from the group consisting of: (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl; and R6 is preferably selected from (C1-C5) alkyl;\n\nR 7 is selected from the group consisting of: hydrogen (H), (C1-C18) alkyl, (C6-C18) aryl, (C7-C18) aralkyl, —CHR8—CR9?CHR10, and —SiR21R22R23, where R21, R22 and R23 are each independently selected from the group consisting of: (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl; and R7 is preferably independently selected from (C1-C5) alkyl or —SiR21R22R23, where R21, R22, and R23 are described above;\n\na is the number 1 or 2; and b is the number zero or one; and \n\nwherein the at least one branched modified polymer macromolecule further comprises ib) at least one of the following structures (ib1-ib4): \n\nib1) a four valent silicon or tin atom, each referred to as (R??) tM group, or a (R??)tM(X)p group, or a M(X)z—(O)x-M(X)z group, wherein M is a tin or a silicon atom, O is an oxygen atom, X is a halide atom, an alkoxy group or a hydroxyl group (—OH group), R?? is an (C1-C6)-alkyl group, z is the number 1 or 2, x is the number zero or 1, p is the number 1 or 2, t is the number 0, 1 or 2, and wherein, for each group, the remaining free valences on M are each linked to an alpha-modified polymer macromolecule;\n\nib2) a group according to Formula 2A:  \n(R 24O)q(R25)rSi—R29—S—Si?R26R27R28??Formula 2A,\n\nwherein, Si and Si? are silicon atoms, S is a sulfur atom and O is an oxygen atom; \n\nR 24 is selected from the group consisting of: hydrogen (H), and (C1-C6) alkyl;\n\nR 25, R26, R27 and R28 are the same or different, and are each independently selected from the group consisting of: hydrogen (H), (C1-C18) alkyl, (C1-C18) alkoxy, (C6-C18) aryl, and (C7-C18) aralkyl, and preferably selected from the group consisting of: (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl; and R25, R26, R27 and R28 are each more preferably independently selected from (C1-C5) alkyl. In another embodiment, R25, R26, R27 and R28 are each independently a (C1-C16) alkyl, more preferably a (C1-C12) alkyl, even more preferably a (C1-C8) alkyl, and most preferably a (C1-C4) alkyl;\n\nR 29 is a divalent group selected from the group consisting of: a di-(C2-C20) alkylether (alkyl-O-alkyl), a (C6-C18) aryl, a (C7-C18) alkylaryl, and a (C1-C18) alkyl, and each group may be substituted with at least one of the following: a (C1-C4) alkyl, a (C1-C4) alkoxy, a R29 (C7-C16) aryl, a (C7-C16) aralkyl, a nitrile, an amine, an NO2, and/or a thioalkyl, and preferably substituted with at least one of the following: a (C1-C4) alkyl, a (C1-C4) alkoxy, a (C7-C16) aryl, and/or (C7-C16) aralkyl; and R29 but is preferably a (C1-C16) alkyl, more preferably a (C1-C12) alkyl, even more preferably a (C1-C8) alkyl, and most preferably a (C1-C5) alkyl. In another embodiment, R29 is a (C7-C25) alkylaryl, more preferably a (C7-C16) alkylaryl, most preferably a (C7-C12) alkylaryl;\n\nq is the number 0 or 1; and r is the number 0 or 1; the sum of q and r (q+r) is the number 0 or 1; and the remaining free valences of the “four valent silicon atom,” Si, are each linked to an alpha-modified polymer macromolecule; \n\nib3) a group according to Formula 2B:  \n(R 24O)q(R25)rSi—R29—S—H??Formula 2B,\n\nwherein, Si is a silicon atom, S is a sulfur atom, O is an oxygen atom, H is a hydrogen atom; \n\nR 24 is selected from the group consisting of: hydrogen (H) and (C1-C6) alkyl;\n\nR 25 is selected from the group consisting of: hydrogen (H), (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl; and R25 is preferably independently selected from (C1-C18) alkyl, (C6-C18) aryl, and (C7-C18) aralkyl; and R25 is more preferably independently selected from (C1-C10) alkyl;\n\nR 29 is a divalent group selected from the group consisting of: a di-(C2-C20) alkylether (alkyl-O-alkyl), an (C6-C18) aryl, a (C7-C18) alkylaryl, and a (C1-C18) alkyl, and each R29 group may be substituted with at least one of the following: a (C1-C4) alkyl, a (C1-C4) alkoxy, a (C7-C16) aryl, a (C7-C16) aralkyl, a nitrile, an amine, a NO2, and/or a thioalkyl, and preferably substituted with at least one of the following: a (C1-C4) alkyl, a (C1-C4) alkoxy, a (C7-C16) aryl, and/or a (C7-C16) aralkyl; and R29 is a (C1-C16) alkyl, more preferably a (C1-C12) alkyl, even more preferably a (C1-C8) alkyl, and most preferably a (C1-C5) alkyl. In another embodiment, R29 is a (C7-C25) alkylaryl, more preferably a (C7-C16) alkylaryl, most preferably a (C7-C12) alkylaryl;\n\nq is the number 0 or 1; and r is the number 0 or 1; the sum of q and r (q+r) is the number 0 or 1; and the remaining free valences of the “four valent silicon atom,” Si, are each linked to an alpha-modified polymer macromolecule; \n\nib4) a group according to Formula 2C:  \n(R 30O)s(R31)tSi—R35—N(H)u(Si?R32R33R34)v??Formula 2C,\n\nwherein, Si and Si? are silicon atoms, S is a sulfur atom, N is a nitrogen atom, and O is an oxygen atom; \n\nR 30 is selected from the group consisting of: hydrogen (H) and (C1-C6) alkyl;\n\nR 31, R32, R33 and R34 are the same or different, and are each independently selected from the group consisting of: hydrogen (H), (C1-C18) alkyl, (C1-C18) alkoxy, (C6-C18) aryl, and (C7-C18) aralkyl; and R31, R32, R33 and R34 are each preferably independently selected from (C1-C18) alkyl, (C1-C18) alkoxy, (C6-C18) aryl, and (C7-C18) aralkyl; and R31, R32, R33 and R34 are each preferably independently selected from (C1-C5) alkyl. In another embodiment, R31, R32, R33 and R34 are each independently a (C1-C16) alkyl, more preferably a (C1-C12) alkyl, even more preferably a (C1-C8) alkyl, and most preferably a (C1-C4) alkyl;\n\nR 35 is a divalent group selected from the group consisting of: a di-(C2-C20) alkylether (alkyl-O-alkyl), an (C6-C18) aryl, a (C7-C18) alkylaryl, and a (C1-C18) alkyl, and each R35 group may be substituted with at least one of the following: a (C1-C4) alkyl, a (C1-C4) alkoxy, a (C7-C16) aryl, a (C7-C16) aralkyl, a nitrile, an amine, an NO2, and/or a thioalkyl, and preferably substituted with at least one of the following: a (C1-C4) alkyl, a (C1-C4) alkoxy, a (C7-C16) aryl, and/or a (C7-C16) aralkyl; and R35 is preferably a (C1-C16) alkyl, more preferably a (C1-C12) alkyl, even more preferably a (C1-C8) alkyl, and most preferably a (C1-C5) alkyl. In another embodiment, R35 is a (C7-C25) alkylaryl, more preferably a (C7-C16) alkylaryl, most preferably a (C7-C12) alkylaryl;\n\ns is the number 0 or 1; and t is the number 0 or 1; the sum of s and t (s+t) is the number 0 or 1; u is the number 0, 1 or 2; v is the number 0, 1 or 2; and the sum of u and v (u+v) is the number 2; and the remaining free valences of the “four valent silicon atom,” Si, are each linked to an alpha-modified polymer macromolecule; and \n\nwherein the at least one linear modified polymer macromolecule further comprises at least one the following structures (iib1: \n\niib1) a tertiary amine group according to Formula 3A: \n\nwherein \n\nC is a carbon atom, N is a nitrogen atom, H is a hydrogen atom; \n\nR 15, R16 and R17 are the same or different, and are each, independently, selected from hydrogen, alkyl, aryl or aralky; preferably selected from hydrogen, methyl, ethyl, propyl, or butyl, and more preferably hydrogen;\n\nR? is selected fro...    1
BRIEF DESCRIPTION OF THE DRAWINGS \n\nIn  FIGS. 1a, 2a, 3a, 4a, 5a, 6a and 7a, cells were treated with rapamycin (Rapa), doxorubicin (Doxo) or dexrazoxone (DexRaz). In FIGS. 1b, 2b, 3b, 4b, 5b, 6b and 7b, cells were subject to oxidative stress alone or following pre-treatment with rapamycin or dexrazoxone. In FIGS. 1c, 2c, 3c, 4c, 5c, 6c and 7c, cells were treated with doxorubicin alone, or following treatment with rapamycin or dexrazoxone. Various effects of the indicated treatments were measured on day 1 (d1) and day 2 (d2).\n\nFIG. 1  illustrates the effects of cell cycle inhibitor drugs and oxidative stress on cell survival and proliferation, as measured using an MTT proliferation assay. FIG. 1a shows the effect of different drugs on cell survival and proliferation. FIG. 1b shows the effects of oxidative stress on cell survival and proliferation. FIG. 1c shows the effects of doxorubicine on cell survival and proliferation.\n\nFIG. 2  illustrates the effects of cell cycle inhibitor drugs and oxidative stress on apoptosis, as measured using FACS analysis. FIG. 2a shows the effect of cell cycle regulator drugs on apoptosis. FIG. 2b shows the effects of oxidative stress on apoptosis. FIG. 2c shows the effects of doxorubicine on apoptosis.\n\nFIG. 3  illustrates the effects of cell cycle inhibitor drugs and oxidative stress on length of the G1 phase of the cell cycle. The y-axis is relative lengthening of the G1 phase of the cell cycle expressed as a percentage. FIG. 3a shows the effect of various drugs on the length of the G1 phase of the cell cycle. FIG. 3b shows the effect of sub-lethal oxidative stress on the length of the G1 phase of the cell cycle. FIG. 3c shows the effect of doxorubicine on the length of the G1 phase of the cell cycle.\n\nFIG. 4  illustrates the effects of cell cycle inhibitor drugs and oxidative stress on length of the G2 phase of the cell cycle. The y-axis is relative lengthening of the G3 phase of the cell cycle expressed as a percentage. FIG. 4a shows the relative change of G2 length under the effect of cell cycle inhibitors. FIG. 4b shows the relative change of G2 length under the effect of oxidative stress. FIG. 4c shows the relative change of G2 length under the effect of doxorubicine.\n\nFIG. 5  illustrates the effects of cell cycle inhibitor drugs and oxidative stress on expression of amyloid precursor protein (APP). The y-axis is percent increase in the amount of protein relative to untreated control culture. The absolute values used to perform this analysis were derived from optical density measurements (OD) obtained from the ELISA assay performed. FIG. 5a shows the effect of cell cycle inhibitor drugs on APP expression. FIG. 5b shows the effect of oxidative stress on APP expression. FIG. 5c shows the effect of doxorubicine on APP expression.\n\nFIG. 6  illustrates the effects of cell cycle inhibitor drugs and oxidative stress on expression of AD-type hyperphosphorylated tau. The y-axis is percent increase in the amount of protein relative to untreated control culture. The absolute values used to perform this analysis were derived from optical density measurements (OD) obtained from the ELISA assay performed. FIG. 6a shows the effect of cell cycle inhibitor drugs on the expression of AD-type hyperphosphorylated tau. FIG. 6b shows the effect of oxidative stress on the expression of AD-type hyperphosphorylated tau. FIG. 6c shows the effect of doxorubicine on the expression of AD-type hyperphosphorylated tau.\n\nFIG. 7  illustrates the effects of cell cycle inhibitor drugs and oxidative stress on expression of AD-type PHF tau. The y-axis is percent increase in the amount of protein relative to untreated control culture. The absolute values used to perform this analysis were derived from optical density measurements (OD) obtained from the ELISA assay performed. FIG. 7a shows the effect of cell cycle inhibitor drugs on the expression of AD-type PHF tau. FIG. 7b shows the effect of oxidative stress on the expression of AD-type PHF tau. FIG. 7c shows the effect of doxorubicine on the expression of AD-type PHF tau.\n\nCROSS-REFERENCE TO RELATED APPLICATIONS \n\nThis application claims priority to U.S. patent application Ser. No. 10/200,023 (filed on Jul. 19, 2002; pending), which application claims priority to GB 0117645.2 (filed Jul. 19, 2001), each of which applications are herein incorporated by reference in its entirety. \n\nFIELD OF THE INVENTION \n\nThe present invention relates to novel strategies for treatment and prevention of Alzheimer's disease. \n\nBACKGROUND OF THE INVENTION \n\nAs life expectancy increases Alzheimer's disease (AD) is becoming a major health problem in the western world. There has been intensive research aimed at identifying a reliable cure or preventive measures for the disease, so far without success. \n\nCurrently there are two mainstream therapeutic approaches to the treatment of Alzheimer's disease. The first is treatment with acetylcholine esterase inhibitors, which reduce the effects of neuron loss in the central nervous system and therefore provide some symptomatic relief for the cognitive defects. However, this approach is appropriate only in those patients in which there is substantial functional reserve left in the brain. \n\nThe second approach is to reduce the amount of or stop the deposition of beta-amyloid plaques in the brain. The main drawback of this approach is that amyloid deposition is not the cause but rather a consequence of Alzheimer's disease, and the accumulation of this protein does not have any effect on the cognitive status or functional capacity of the brain. \n\nIn recent years it is becoming more widely accepted that the pathogenic basis of Alzheimer's disease is the aberrant re-entry of different neuronal populations into the cell division cycle (Nagy Z, Esiri M M and Smith A D (1998)  Neuroscience 84: 731-739). In healthy elderly individuals rapid cell cycle arrest and re-differentiation may follow this cell cycle re-entry. In contrast, in individuals with Alzheimer's disease the regulatory mechanisms appear to fail and the neurons progress into the late stages of the cell cycle leading to the accumulation of AD-related pathology and/or neuronal death (Nagy Z, Esiri M M and Smith A D (1998) Neuroscience 84: 731-739).\n\nStudies by the present inventors and others indicate that the cell cycle regulatory failure in Alzheimer's disease occurs at the G1/S transition checkpoint (Arendt T, Rodel L, Gartner U and Holzer M (1996)  Neuroreport 7: 3047-9). Previous studies on fibroblasts and lymphocytes from Alzheimer's disease patients indicate that the regulation of the cell division cycle might be disrupted in cells other than neurons in this condition (Eckert A, Hartmann H, Forstl H and Muller W E (1994) Life Sci 55: 2019-29; Fischman H K, Reisberg B, Albu P, Ferris S H and Rainer J D (1984) Biol Psychiatry 19: 319-27; Tatebayashi Y, Takeda M, Kashiwagi Y, Okochi M, Kurumadani T, Sekiyama A, Kanayama G, Hariguchi S and Nishimura T (1995) Dementia 6: 9-16). It is also known that Alzheimer's disease patients are more prone to some forms of cancer (Burke W J, McLaughlin J R, Chung H D, Gillespie K N, Grossbcrg G T, Luque F A and Zimmerman J (1994) Alzheimer Dis Assoc Disord 8: 22-8) and that Down's syndrome patients, who develop AD in early adult life, are more prone to leukaemia than the general population (Drabkin H A and Erickson P (1995) Prog Clin Biol Res 393: 169-76; Fong C T and Brodeur G M (1987) Cancer Genet Cytogenet 28: 55-76). It is plausible therefore to hypothesize that the cell cycle regulatory failure in neurons, even in early (pre-clinical) stages of AD, might be reflected by similar cell cycle regulatory malfunction in lymphocytes.\n\nSUMMARY OF THE INVENTION \n\nThe present inventor has shown that the in vitro responsiveness of lymphocytes to G1 inhibitor treatment is significantly less effective in Alzheimer's disease patients than in control subjects. Additionally, in subjects showing clinical signs of incipient Alzheimer's disease the lymphocyte response is similar to that seen in Alzheimer's disease patients. These findings represent direct evidence that failure of the G1/S transition control is not restricted to neurons in Alzheimer's disease patients, but also occurs in peripheral cells, such as lymphocytes. \n\nThe two main targets of therapeutic intervention identified by the inventor are to prevent/inhibit cell cycle re-entry and progression to the G1/S transition point, or to prevent/inhibit the cell cycle progression at the G1/S transition point. \n\nAccording to one aspect of the invention, methods of treating or preventing Alzheimer's disease in a human patient are provided. The methods include administering to a human patient in need thereof an effective amount of one or more inhibitors of cell cycle re-entry and progression to the G1/S transition. In certain embodiments, the inhibitor of cell cycle re-entry and progression to the G1/S transition is an inhibitor of the G0/G1 transition, and in other embodiments the inhibitor of cell cycle re-entry and progression to the G1/S transition induces cell cycle arrest in the G0/G1 phase. \n\nPreferred inhibitors of cell cycle re-entry and progression to the G1/S transition for use in the foregoing methods include NA22598, sodium valproate, fascaplysin and brefeldin A. \n\nAccording to another aspect of the invention, additional methods of treating or preventing Alzheimer's disease in a human patient are provided. The methods include administering to a human patient in need thereof an effective amount of one or more inhibitors of progression of the cell cycle through the G1/S transition point. In some embodiments, the inhibitor of progression of the cell cycle through the G1/S transition point blocks cell cycle progression in G1, and/or induces cell cycle arrest in G1, and/or induces cell cycle arrest at the G1/S checkpoint, and/or blocks the G1/S transition, and/or inhibits DNA synthesis. \n\nPreferred inhibitors of progression of the cell cycle through the G1/S transition point include squamocin, peptide aptamers which specifically inhibit E2F binding activity, manumycin A, indole carbazolc K252a, 4-sodium phenyl butyrate, retinoids or retinoid receptor selective ligands, combinations of oncostatin M and interleukin 6, an ansamycin (preferably herbimycin, geldanamycin or TT-B), vitamin D analogs, steroids or glucocorticoids, alpha adrenergic receptor antagonists (preferably doxazosin), iron chelators (preferably O-Trensox, desferrioxamine, an aroylhydrazone ligand, dexrazoxane or EDTA), angiotensin II receptor antagonists (preferably bradykinin), immunosuppressive chemotherapeutic drugs (preferably doxorubicin, adriamycin, rapamycin, cyclosporin A, FK506 or a prodigiosin), and melatonin. \n\nThe foregoing inhibitors of cell cycle re-entry and progression to the G1/S transition and inhibitors of progression of the cell cycle through the G1/S transition point can be administered alone or in combination with other of these inhibitors, or in combination with one or more non-cell cycle therapeutic agents for treating Alzheimer's disease, such as acetylcholine esterase inhibitors (such as donepezil, rivastigmine and galantamine), beta- and gamma-secretase inhibitors, Abeta vaccines, Cu—Zn chelators, cholesterol-lowering drugs and non-steroidal anti-inflammatory drugs. Preferred combinations of cell cycle therapeutic agents include doxorubicin and rapamycin (particularly administration of the rapamycin followed by the administration of the doxorubicin), and dexrazoxane and doxorubicin (particularly administration of the dexrazoxone followed by the administration of the doxorubicin). \n\nAccording to a further aspect of the invention, methods of selecting a pharmaceutical agent for use in the treatment Alzheimer's disease in a human patient are provided. The methods include the steps of (a) exposing cells from the patient, which cells are non-neuronal cells that exhibit a cell cycle regulatory defect at the G1/S phase transition, to a panel of pharmaceutical agents which are known inhibitors of cell cycle re-entry and progression to the G1/S transition or known inhibitors of progression of the cell cycle through the G1/S transition point, (b) analyzing the regulation of the G1/S transition the cells in the presence and absence of the pharmacological agents, and (c) identifying an agent which corrects the regulatory defect at the G1/S transition in the cells, which agent is identified as likely to be of benefit in the treatment of Alzheimer's disease in the patient. In some embodiments, the panel of pharmaceutical agents includes one or more inhibitors of cell cycle re-entry and progression to the G1/S transition and/or one or more inhibitors of progression of the cell cycle through the G1/S transition point as described herein. \n\nIn another aspect of the invention, methods of screening compounds for potential pharmacological activity in the treatment of Alzheimer's disease are provided. The methods include contacting SH-SY5Y neuroblastoma cells with candidate compounds and testing for at least one parameter indicative of Alzheimer's disease pathology selected from the group consisting of: (i) cell survival and proliferation, (ii) apoptosis, (iii) relative lengthening of the G1 phase of the cell cycle, (iv) relative lengthening of the G2 phase of the cell cycle, (v) expression of amyloid precursor protein (APP), (vi) expression of hyperphosphorylated tau protein, and (vii) expression of PHF tau protein. Candidate compounds which cause a reduction in the tested parameter(s), as compared to control cells not exposed to the candidate compound, are scored as having potential pharmacological activity in the treatment of Alzheimer's disease. \n\nIn some embodiments, the candidate compound to be tested using the method is a known inhibitor of cell cycle re-entry and progression to the G1/S transition or a known inhibitor of progression of the cell cycle through the GUS transition point. \n\nAccording to yet another aspect of the invention, pharmaceutical kits for treating Alzheimer's disease are provided. The kits include a therapeutically effective amount of one or more cell cycle therapeutic agents for treating Alzheimer's disease selected from one or more inhibitors of cell cycle re-entry and progression to the G1/S transition and/or inhibitors of progression of the cell cycle through the G1/S transition point. In certain embodiments, combinations of cell cycle therapeutic agents are provided in the kits, such as doxorubicin and rapamycin, or dexrazoxone and doxorubicin. In other embodiments, the kits can also include a non-cell cycle therapeutic agent for treating Alzheimer's disease. The kits preferably also will contain instructions for simultaneous, separate or sequential administration of the cell cycle therapeutic agent and optionally the non-cell cycle therapeutic agent for treating Alzheimer's disease. \n\nThese and other embodiments of the invention are described in greater detail below. \n\nDETAILED DESCRIPTION OF THE INVENTION \n\nThe invention relates to several strategies for therapeutic intervention in order to arrest progression of Alzheimer's disease or to prevent its development. \n\nThe two main targets of therapeutic intervention identified by the inventor are to prevent/inhibit cell cycle re-entry and progression to the G1/S transition point, or to prevent/inhibit the cell cycle progression at the G1/S transition point. Neuronal cell cycle re-entry can be prevented by therapies that act as differentiation factors or by interventions that reinforce synaptic connections and therefore the differentiated state of neurons. Therapies aimed at arresting the progression of the cell division cycle at the G1/S transition point include treatment with classical inhibitors of cell division, for example drugs used in cancer therapy and chemo-prevention. \n\nThe preferred agent for treatment of Alzheimer's disease in any given patient will vary depending on the precise nature of the underlying cell cycle regulatory defect present in that patient. It is not the case that all agents that prevent cell cycle re-entry and progression to the G1/S transition point, or which prevent the cell cycle progression at the G1/S transition point, will be effective in all Alzheimer's patients. The inventor's finding that the failure of the G1/S transition control is not restricted to neurons in Alzheimer's disease patients, but also occurs in peripheral cells, such as lymphocytes, has led to the development of an in vitro assay which can be used to identify and select agents which are effective in a particular patient. The ability to select an agent that will work in a given patient via a simple in vitro test is absolutely critical. Prior to the development of this in vitro screen it would simply not have been possible to select an agent having clinical utility in a particular patient without to extensive, ethically unacceptable, “trial and error” in that patient. \n\nIn summary, the development of an in vitro screen which can be used identify agents capable of correcting the cell cycle regulatory defects present in Alzheimer's patients has made it possible for the first time to provide effective treatment and prophylaxis for Alzheimer's disease based on prevention/inhibition of cell cycle re-entry and progression to the G1/S transition point, or on prevention/inhibition of cell cycle progression at the G1/S transition point. \n\nTherefore, in a first aspect the invention relates to use of at least one substance which is an inhibitor of cell cycle re-entry and progression to the G1/S transition for the manufacture of a medicament for the treatment or prevention of Alzheimer's disease. \n\nThe invention is also directed to method of treating or preventing Alzheimer's disease in a human patient comprising administering to a human patient in need thereof an effective amount of an inhibitor of cell cycle re-entry and progression to the G1/S transition. \n\nInhibitors of cell cycle re-entry and progression to the G1/S transition may act via various mechanisms, for example inhibition of the G0/G1 transition, or induction of cell cycle arrest in the G0/G1 phase. \n\nPreferably the inhibitor of cell cycle re-entry and progression to the G1/S transition will be a substance that, when assessed using the in vitro assay described herein, produces significant correction of the cell cycle regulatory defect at the G1/S transition in an Alzheimer's patient, most preferably the Alzheimer's patient which it is intended to treat using the substance. \n\nPreferred known inhibitors of cell cycle re-entry and progression to the G1/S transition, which may be used in accordance with this aspect of the invention, include the following, however this is not to be construed as limiting the invention to these specific embodiments: \n\nNA22598—an anticancer drug that inhibits G0/G1 transition (Kawada, M., Kuwahara, A., et al. (1999)  Exp Cell Res, 249(2): 240-247).\n\nSodium valproate and its derivatives—an inhibitor of the growth of human neuroblastoma cells and known antiepileptic agent (Cinatl, J. Jr., Cinatl, J., et al. (1997)  Anticancer Drugs, 8(10): 958-963; Cinatl, J. Jr., Cinatl, J., et al. (1996) Anticancer Drugs, 7(7): 766-773).\n\nFascaplysin—which specifically inhibits cdk4 therefore inhibiting the G0/G1 transition (Soni, R., Muller, L., et al. (2000).  Biochem Biophys Res Comm, 275(3): 877-884).\n\nBrefeldin A—which induces cell cycle arrest in the G0/G1 phase (Nojiri, H., Manya, H., et al. (1999)  FEBS Lett, 453(1-2): 140-144).\n\nIn a second aspect the invention is relates to use of at least one substance which is an inhibitor of progression of the cell cycle through the G1/S transition point for the manufacture of a medicament for the treatment or prevention of Alzheimer's disease. \n\nThe invention is also directed to a method of treating or preventing Alzheimer's disease in a human patient comprising administering to a human patient in need thereof an effective amount of an inhibitor of progression of the cell cycle through the G1/S transition point. \n\nInhibitors of progression of the cell cycle through the G1/S transition point may act via various mechanisms. For example, they may block cell cycle progression in G1, induce cell cycle arrest in G1, induce cell cycle arrest at the G1/S checkpoint via various pathways, block the G1/S transition, or inhibit DNA synthesis. \n\nPreferably the inhibitor of progression of the cell cycle through the G1/S transition point will be a substance that, when assessed using the in vitro assay described herein, produces significant correction of the cell cycle regulatory defect at the G1/S transition in an Alzheimer's patient, most preferably the Alzheimer's patient which it is intended to treat using the substance. \n\nPreferred known inhibitors of progression of the cell cycle through the G1/S transition point, which may be used in accordance with this aspect of the invention, include the following, however this is not to be construed as limiting the invention to these specific embodiments: \n\nSquamocin—an annonaceous acetogenin which blocks cell cycle progression in the G1 phase (Raynaud, S., Nemati, F., et al. (1999)  Life Science, 65(5): 525-533).\n\nPeptide aptamers that functionally antagonize E2F activity—suitable peptide aptamers are those described and shown to be inhibitors of the cell cycle in G1 by Fabbrizio, E., Le Cam, L., et al. (1999)  Oncogene, 18(30): 4357-4363.\n\nManumycin A—shown to cause G1 arrest (Wang, W. and Macaulay, R. J. (1999)  Int J Cancer, 82(3): 430-434).\n\nIndole carbazole K252a—a compound shown to cause cell cycle arrest at the G1/S checkpoint via p21 (Chin, L. S., Murray, S. F., et al. (1999)  Cancer Invest., 17(6): 391-395).\n\nOncostatin M and interleukin 6 in combination—this combination of cytokines induces cell cycle arrest at G1/S via p27 (Klausen, P., Pedersen, L., et al. (2000)  Oncogene, 19(32): 3675-3683).\n\n4-sodium phenylbutyrate—an agent that has been used for many years in the treatment of urea cycle defects, which has been shown to cause cell cycle arrest in G1 via p21 (McGrath-Morrow, S. A. and Stahl, J. L. (2000)  J Pharmacol Exp Ther, 294(3): 941-947).\n\nRetinoids and retinoid receptor selective ligands (e.g. ligands which mimic the effect of retinoic acid binding to the retinoid receptor, for example Targretin)—suitable retinoids include retinoic acid, which has been shown to mediate cell cycle arrest in G1 (Hsu, S. L., Hsu, J. W. et al. (2000)  Exp Cell Res, 258(2): 322-331).\n\nAnsamycins—members of the ansamycin class of antibiotics have been shown to inhibit the growth of human tumor cell lines in vitro. Suitable ansamycins include thiazinotrienomycin B (TT-B), shown to inhibit cell cycle progression from G0/G1 to S (Hosokawa, N., Yamamoto, S., et al. (1999)  J. Antibiot, 52(5): 485-490; Hosokawa, N., Naganawa, H., et al. (2000) J. Antibiot, 53(9): 886-894), and related compounds such as, for example, herbimycin and geldanamycin.\n\nVitamin D analogs—suitable analogs include, but are not limited to, the compounds EB1089 and CB1093, which have been shown to cause cell cycle arrest in the G0/G1 phase (Pettersson, F., Colston, K. W., et al. (2000)  Br J Cancer, 83(2): 239-245).\n\nGlucocorticoids—suitable glucocorticoids include, but are not limited to, the synthetic glucocorticoid dexamethasone, which has been shown to induce cell cycle arrest in G1 via p27 and p57 (Samuelsson, M. K., Pazirandeh, A., et al. (1999)  Mol Endocrinol, 13(11): 1811-1822).\n\nAlpha adrenergic receptor antagonists—suitable examples include the alpha1-adrenergic receptor antagonist doxazosin, which has been shown to induce cell cycle arrest in G1 via p27 (Kintsher, U., Kon, D., et al. (2001)  J Cardiovasc Pharmacol, 37(5): 532-539; Kintsher, U., Wakino, S., et al. (2000) Arterioscler Thromb Vasc Biol, 20(5): 1216-1224).\n\nIron chelators—suitable examples include EDTA, dexrazoxane, the synthetic iron chelator O-Trensox and desferrioxamine, both of which have been shown to block the G1/S transition (Rakba, N., Loyer, P., et al. (2000)  Carcinogenesis, 21(5): 943-951) and also aroylhydrazone iron chelators of the pyridoxal isonicotinoyl hydrazone class, such as those shown by Becker, E. and Richardson, D. R. (1999) J Lab Clin Med, 134(5): 510-521 to be mediators of cell cycle arrest at G1/S.\n\nAngiotensin II receptor antagonists—suitable examples include bradykinin, which is known to inhibit DNA synthesis (Patel, K. V. and Schrey, M. P. (1992)  Cancer Res, 52(2): 334-340).\n\nImmunosuppressive chemotherapeutic drugs—suitable examples are Doxorubicin, Adriamycin, Rapamycin, Cyclosporin A, FK506 (Tacrolimus) and compounds of the prodigiosin family. These immunosuppressive drugs are all known to promote G1 inhibition via p21 and p27. \n\nMelatonin—which is known to induce G1/S inhibition (Urata, Y., Honma, S., et al. (1999)  Free Radic Biol Med, 27(7-8): 838-847).\n\nThe above agents may also be used in combination in order to achieve the desired therapeutic effect. Certain combinations of agents may act co-operatively, additively or synergistically, when co-administered or when administered sequentially. A preferred combination is doxorubicin with rapamycin. Most preferably the two agents are administered sequentially, rapamycin followed by doxorubicin. As illustrated in the accompanying Examples, a combined treatment with rapamycin and doxorubicin has a strong protective effect against the accumulation of AD-related proteins. A further preferred combination is dexrazoxane with doxorubicin. Again the two agents are most preferably administered sequentially, dexrazoxone followed by doxorubicin. As illustrated in the accompanying Examples, treatment with dexrazoxane followed by doxorubicin enhances protection against AD-related protein expression. \n\nThe invention is also directed to the use of pharmaceutically acceptable salts of the agents listed above, and to derivatives of the listed agents which retain the desired activity of inhibiting cell cycle re-entry and progression to the G1/S transition point, or inhibiting cell cycle progression at the G1/S transition point. Derivatives that substantially retain the same activity as the starting material, or more preferably exhibit improved activity, may be produced according to standard principles of medicinal chemistry, which are well known in the art. Such derivatives may exhibit a lesser degree of activity than the starting material, so long as they retain sufficient activity to be therapeutically effective. Derivatives may exhibit improvements in other properties that are desirable in pharmaceutical active agents such as, for example, improved solubility, reduced toxicity, enhanced uptake into the brain, etc. \n\nThe above-listed agents, or pharmaceutically acceptable salts or derivatives thereof, may be formulated into pharmaceutical dosage forms, together with suitable pharmaceutically acceptable carriers, such as diluents, fillers, salts, buffers, stabilizers, solubilizers, etc. The dosage form may contain other pharmaceutically acceptable excipients for modifying conditions such as pH, osmolarity, taste, viscosity, sterility, lipophilicity, solubility etc. \n\nSuitable dosage forms include solid dosage forms, for example, tablets, capsules, powders, dispersible granules, cachets and suppositories, including sustained release and delayed release formulations. Powders and tablets will generally comprise from about 5% to about 70% active ingredient. Suitable solid carriers and excipients are generally known in the art and include, e.g. magnesium carbonate, magnesium stearate, talc, sugar, lactose, etc. Tablets, powders, cachets and capsules are all suitable dosage forms for oral administration. \n\nLiquid dosage forms include solutions, suspensions and emulsions. Liquid form preparations may be administered by intravenous, intracerebral, intraperitoneal, parenteral or intramuscular injection or infusion. Sterile injectable formulations may comprise a sterile solution or suspension of the active agent in a non-toxic, pharmaceutically acceptable diluent or solvent. Suitable diluents and solvents include sterile water, Ringer's solution and isotonic sodium chloride solution, etc. Liquid dosage forms also include solutions or sprays for intranasal administration. \n\nAerosol preparations suitable for inhalation may include solutions and solids in powder form, which may be combined with a pharmaceutically acceptable carrier, such as an inert compressed gas. \n\nAlso encompassed are dosage forms for transdermal administration, including creams, lotions, aerosols and/or emulsions. These dosage forms may be included in transdermal patches of the matrix or reservoir type, which are generally known in the art. \n\nPharmaceutical preparations may be conveniently prepared in unit dosage form, according to standard procedures of pharmaceutical formulation. The quantity of active compound per unit dose may be varied according to the nature of the active compound and the intended dosage regime. Generally this will be within the range 0.1 mg to 1000 mg. \n\nOther delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of the therapeutic agents of the invention described herein, increasing convenience to the subject and the physician. Many types of release delivery systems are available and known to those of ordinary skill in the art. They include polymer based systems such as poly(lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides. Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S. Pat. No. 5,075,109. Delivery systems also include non-polymer systems that are: lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono- di- and tri-glycerides; hydrogel release systems; sylastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like. Specific examples include, but are not limited to: (a) erosional systems in which the therapeutic agent(s) of the invention are contained in a form within a matrix such as those described in U.S. Pat. Nos. 4,452,775, 4,675,189, and 5,736,152, and (b) diffusional systems in which an active component permeates at a controlled rate from a polymer such as described in U.S. Pat. Nos. 3,854,480, 5,133,974 and 5,407,686. In addition, pump-based hardware delivery systems can be used, some of which are adapted for implantation. \n\nUse of a long-term sustained release implant may be particularly suitable for treatment of chronic conditions such as Alzheimer's disease. Long-term release, are used herein, means that the implant is constructed and arranged to delivery therapeutic levels of the active ingredient for at least 30 days, and preferably 60 days. Long-term sustained release implants are well-known to those of ordinary skill in the art and include some of the release systems described above. \n\nIn some embodiments, the invention involves co-administration of at least two different types of therapeutic agent for treating Alzheimer's disease. Thus, the invention provides methods and products for combination therapy in which a first therapeutic agent (e.g., an inhibitor of cell cycle re-entry and progression to the G1/S tra...    1
Name: Description, Length: 2784, dtype: int64


Assignee/Applicant (Original Language)
Canon Kabushiki Kaisha,Tokyo,JP                                                                                                                                                                                                                            8
Sony Corporation,Tokyo,JP                                                                                                                                                                                                                                  6
International Business Machines Corporation,Armonk,NY,US                                                                                                                                                                                                   6
Seagate Technology LLC,Cupertino,CA,US                                                                                                                                                                                                                     5
Samsung Electronics Co. Ltd.,Suwon-si,KR                                                                                                                                                                                                                   4
                                                                                                                                                                                                                                                          ..
Centre National de la Recherche Scientifique,Paris,FR | Bondu François,Servon sur Vilaine,FR | Brunel Marc,Rennes,FR | Alouini Mehdi,Gosne,FR | Vallet Marc,Thorigne-Fouillard,FR | Loas Goulc'hen,Saint Aubin d'Auligne,FR | Romanelli Marco,Rennes,FR    1
Covidien LP,Mansfield,MA,US | Kleyman Gennady,Brooklyn,NY,US | Okoniewski Gregory G.,North Haven,CT,US                                                                                                                                                     1
ZF Friedrichshafen AG,Friedrichshafen,DE | Hunold Bernard,Friedrichshafen,DE | Lubke Eckhardt,Friedrichshafen,DE | Renner Stefan,Bodman-Ludwigshafen,DE                                                                                                    1
Alcon Research Ltd.,Fort Worth,TX,US | Chowhan Masood A.,Arlington,TX,US | Ghosh Malay,Fort Worth,TX,US | Asgharian Bahram,Arlington,TX,US | Han Wesley Wehsin,Arlington,TX,US                                                                             1
Isis Innovation Ltd.,Oxford,GB                                                                                                                                                                                                                             1
Name: Assignee/Applicant (Original Language), Length: 2704, dtype: int64


Assignee - Original
Samsung Electronics Co. Ltd.                                                                                                                    12
Canon Kabushiki Kaisha                                                                                                                           9
Sony Corporation                                                                                                                                 7
Semiconductor Energy Laboratory Co. Ltd.                                                                                                         6
International Business Machines Corporation                                                                                                      6
                                                                                                                                                ..
Pak James Nohak | Park No Ohk | Yoon Jae Woon | Kim Nam Ki                                                                                       1
Ecovacs Robotics Suzhou Co. Ltd. | Tang Jinju                                                                                                    1
Zep Solar LLC | West John R.                                                                                                                     1
Centre National de la Recherche Scientifique | Bondu François | Brunel Marc | Alouini Mehdi | Vallet Marc | Loas Goulc'hen | Romanelli Marco     1
Isis Innovation Ltd.                                                                                                                             1
Name: Assignee - Original, Length: 2672, dtype: int64


Optimized Assignee
SAMSUNG ELECTRONICS CO LTD                        50
QUALCOMM INC                                      36
CANON INC                                         29
GENERAL ELECTRIC COMPANY                          24
INTERNATIONAL BUSINESS MACHINES CORP              23
                                                  ..
KALLIS TECH SERVICES                               1
TOYOTA MOTOR CORP | DENSO CORP | DENSO TEN LTD     1
NEOPERL GMBH                                       1
GAS TECHNOLOGY INSTITUTE                           1
LCR HOLDING CORP                                   1
Name: Optimized Assignee, Length: 1484, dtype: int64


Ultimate Parent
SAMSUNG ELECTRONICS CO LTD                          67
QUALCOMM INC                                        38
CANON INC                                           33
INTERNATIONAL BUSINESS MACHINES CORP                26
MICROSOFT CORPORATION                               26
                                                    ..
AVIENT CORP (FORMERLY POLYONE CORPORATION)           1
TOKYO OHKA KOGYO                                     1
INSTITUT FRANCAIS DU PETROLE                         1
MITSUI HIGH-TEC CO LTD                               1
ZIMVIE INC. (SPINOFF OF DENTAL & SPINE BUSINESS)     1
Name: Ultimate Parent, Length: 1317, dtype: int64


Inventor
Matsuda, Yoshimoto                                                                                                    3
Collard, Joseph | Khorkova Sherman, Olga                                                                              2
Horstman, John Bernard | Swier, Steven                                                                                2
Visenzi, Giuseppe                                                                                                     2
Sasaki, Yasushi | Murakami, Yuhichiroh | Yamamoto, Etsuo                                                              2
                                                                                                                     ..
Murphy, Joseph | Hartmann, Lucas | Stone, Randall G. | Jozwik, Keith                                                  1
Broer, Dirk Jan | Peeters, Emiel                                                                                      1
Braeckman, Karl Ghislain | Krols, Roel | Bettiol, Jean-Luc Philippe                                                   1
Muthuppalaniappan, Meyyappan | Viswanadha, Srikant | Merikapudi, Gayatri Swaroop | Vakkalanka, Swaroop Kumar V. S.    1
Nagy, Zsuzsanna                                                                                                       1
Name: Inventor, Length: 2766, dtype: int64


Attorney/Agent
Not available                                                226
Oblon, Spivak, McClelland, Maier & Neustadt, L.L.P.           63
Sughrue Mion, PLLC                                            55
Fish & Richardson P.C.                                        36
Birch, Stewart, Kolasch & Birch, LLP                          35
                                                            ... 
Gex, Gary                                                      1
Reed Smith LLP | Riddle, Robert R.                             1
Guntin & Gust, PLC | Trementozzi, Ralph                        1
Venjuris PC                                                    1
Auerbach, Jeffrey I. | Kreppel, Lisa | AuerbachSchrot LLC      1
Name: Attorney/Agent, Length: 1147, dtype: int64


Examiner
Marinelli, Patrick F                   7
Lian, Mangtin                          6
Gerrity, Stephen F                     5
Mullins, Burton                        5
Lee, John J                            5
                                      ..
Mitchell, Katherine / Denion, Scott    1
Snyder, Adam J                         1
Mehmood, Jennifer / Alam, Mirza        1
Bastianelli, John                      1
Philogene, Pedro / Comstock, David     1
Name: Examiner, Length: 2150, dtype: int64


Publication Country Code
US    2784
Name: Publication Country Code, dtype: int64


Dead/Alive
Alive    1797
Dead      987
Name: Dead/Alive, dtype: int64


Application Country/Region
US    2784
Name: Application Country/Region, dtype: int64


Priority Date - Earliest
2011-06-29    8
2012-04-27    8
2011-12-22    8
2010-02-12    8
2010-10-19    8
             ..
2008-05-15    1
2008-05-19    1
2008-05-14    1
2008-05-22    1
2001-07-19    1
Name: Priority Date - Earliest, Length: 1467, dtype: int64


IPC Class
H04              257
A61              187
H01              187
G06              166
G06, H04          92
                ... 
G06, H04, G11      1
B23, H05           1
B01, F23           1
F16, G05           1
C12, A61, C07      1
Name: IPC Class, Length: 940, dtype: int64


CPC Class
H04                   269
A61                   174
G06                   120
H01                   107
G06, H04               49
                     ... 
F04, F16                1
B42, B41, C09, Y10      1
F01, C23, F05, Y02      1
G01, C07, A61           1
G06, G11, H03           1
Name: CPC Class, Length: 1115, dtype: int64


US Class - Original
370329                                                                                 7
382128                                                                                 7
370328                                                                                 5
370392                                                                                 3
377064 | 377068 | 377079                                                               3
                                                                                      ..
429430 | 429431 | 429535                                                               1
435128 | 435193 | 435121 | 435122                                                      1
439320 | 439585 | 439461                                                               1
250436 | 250435 | 252180 | 2107481                                                     1
5140178 | 514034 | 514183 | 51425217 | 514557 | 435029 | 435366 | 435004 | 43500724    1
Name: US Class - Original, Length: 2698, dtype: int64


Cited Refs - Patent
CN2544162Y | US7516565B1 | CN2741495Y | US5609047A | US6295691B1 | US20050274403A1 | CN101022898A | JP2001327449A | WO2008012661A2 | WO2001021054A1 | WO2006014311A1 | CN2639658Y | CN2644027Y | EP1223844A1 | JP9154569A | KR2007119256A | CN2577987Y | DE202004014412U1 | US20060000049A1 | CN2389017Y | CN1500565A | JP2003526489A | US7237409B2 | EP719516A2 | JP58156587U | KR2007016449A | US7475448B2 | US20050125934A1 | CN1439836A | DE2004014412U1 | US3000036A | US20030145880A1 | US20050161538A1 | US20110073135A1 | CN2568904Y | CN2689033Y                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  1
US20140169268A1 | FR2953357A1 | US20100177685A1 | US20100061226A1 | EP2071807A1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            1
US6407854B1 | JP8204267A | JP2003051632A | JP2005192256A | US5986799A | US6476961B1 | US20060215716A1 | US6661570B2 | US6166850A | US5633750A | US6342959B1 | US7038769B2 | JP11026848A | US5267071A | US8339698B2 | JP2000151515A | US5701195A | US20100157415A1 | US8094369B2 | US6396625B1 | JP8032162A | US20120050845A1 | US5680246A | US6433925B1 | US5572356A | US6356386B1 | US5268786A                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            1
US20090084426A1 | US20100154864A1 | US6750391B2 | US20110048507A1 | US20080283118A1 | US20090165838A1 | WO2010144637A1 | US20050217716A1 | US20060118163A1 | WO2007136318A1 | US20090078299A1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1
US7722829B2 | US20070104623A1 | US7062904B1 | US8093173B2 | US8512657B2 | US20080045405A1 | US20080148700A1 | EP1657410A2 | WO2009079590A1 | US20050207946A1 | US5198007A | US7179430B1 | WO2008132452A2 | US20100092358A1 | US8318286B2 | US20030101718A1 | DE102005005663A1 | EP2105200A1 | WO2008022967A1 | US7972400B2 | US8012439B2 | US20060193757A1 | US4689150A | US6264045B1 | US20050074374A1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    1
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ..
EP874041A1 | WO2006041740A1 | US6008181A | US20070123447A1 | EP855438A1 | JP2005053971A | EP2264138A1 | JP11012596A | USH1559H1 | US5968888A | US20050107275A1 | WO1995033025A1 | US20050170990A1 | US20120046213A1 | JP2009185252A | US20060079433A1 | JP60081298A | WO1995007969A1 | US4075129A | WO1998056884A1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         1
US20090311720A1 | JP2000256358A | WO2003045912A1 | WO2006115140A1 | WO2007109362A2 | WO2009017818A1 | WO2009035818A1 | WO2010034011A2 | US20010044445A1 | WO2005009954A2 | WO2008148108A1 | WO2009076454A2 | WO2010039238A1 | US6696267B2 | US20090131484A1 | US20100087415A1 | WO2005095351A1 | WO2006034402A2 | WO2006081389A1 | WO2007087427A2 | WO2007087442A2 | US20100152241A1 | WO2002089793A1 | WO2006050214A2 | WO2007087429A2 | WO2007087441A2 | WO2007121186A2 | WO2008103310A1 | WO2009017819A1 | WO2010027875A2 | WO2010039236A1 | WO2010039237A1 | US7452675B2 | EP1875925A1 | WO1999062885A1 | WO2003022852A2 | WO2004078995A2 | WO2005113511A1 | WO2007087443A2 | WO2007112093A2 | WO2008063504A2 | WO2010025295A2 | US20060173006A1 | US20070249051A1 | WO2007139926A2 | WO2008106731A1 | WO2009017831A1 | WO2009038775A1 | WO2009089305A1 | WO2010034003A2 | US6348480B1 | US20090023177A1 | US20110112058A1 | WO2007089904A2 | WO2010048559A2 | US20080293092A1 | WO2005009539A2 | WO2006081391A2 | WO2007004038A1 | WO2008016643A2 | WO2008039520A2    1
WO2004069156A2 | US6330811B1 | CN1330253A | US20080193427A1 | CN101056972A | RU2261610C1 | WO2001095741A1 | WO2006027265A1 | WO2001025411A1 | US7037708B1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  1
DD242232A1 | US4689368A | US5866650A | US6103842A | US6489415B2 | US5959048A | WO2010056694A1 | US3951936A | US4474908A | US5753579A | US6046288A | US6184168B1 | DE242232C1 | JP11301794A | JP2006241355A | US3692874A | US4616069A | US5834573A | US6229036B1 | US6310152B1 | US6777569B1 | DE236321C1 | WO2002024764A1 | US3629213A | US5089574A | US5753761A | US6080835A | DE237513C1 | EP964008A1 | WO2007047943A2 | WO2009148932A1 | DD237513A1 | DD236321A1 | US3078254A | US3281383A | US4048206A | US5086136A | US5218023A | US5448002A | US5502131A | US5786441A | US5792820A | US5916961A | US6025450A | EP1367069A1 | US3978103A | US4931376A | US5134199A | US6627715B2 | US20030065114A1 | US20050124740A1 | EP924214A2 | WO2009077837A1 | WO2011079922A1 | US3244664A | US6018007A | US6693160B1 | US20110082253A1 | EP593049A1 | WO2008130782A1                                                                                                                                                                                                           1
US6147094A | US6264994B1 | JP1997221421A | JP2000290184A | WO2000019200A1 | WO2001012236A2 | WO2001056982A1 | WO2002073212A2 | WO2003083067A2 | JP9221421A | WO1998051702A1 | WO1999037294A2 | WO2001000619A1 | US5922761A | WO1998047854A1 | US5663201A | WO1993011762A1 | WO1996009299A1 | WO1998009523A1 | WO2001051464A1 | WO1994000095A2 | WO1998025887A2 | WO1999048489A2 | US7842455B2 | EP778023A1 | US6187950B1 | EP1006108A1 | EP1239038A1 | GB2314268A | WO1998002435A1 | WO2001010829A1 | WO2004002488A1 | US5846984A | US8137916B2 | US8343926B2                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1
Name: Cited Refs - Patent, Length: 2778, dtype: int64


Cited Refs - Non-patent
Not available                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   911
Etienne et al., 2006, “Polyelectrolyte Multilayer Film Coating and Stability at the Surfaces of Oral Prosthesis Base Polymers: An in vitro and in vivo Study, ” J. Dental Research 85(1):44-48. 3 |  Green et al., 1999, Protective Groups in Organic Synthesis, New York, NY pp. 67-74 and 708-711. |  International Search Report and Written Opinion in International Application No. PCT/US10/061704, mailed Apr. 19, 2011. |  International Search Report and Written Opinion in International Application No. PCT/US10/061708, mailed Jul. 5, 2011. |  International Search Report in International Application No. PCT/US09/054582, mailed Aug. 21, 2009. |  Tangerman, 2002, “Halitosis in Medicine: A Review, ” International Dental J. 52(Supp. 3):201-206.  |  Written Opinion in International Application No. PCT/US10/061704, mailed Jan. 27, 2012.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 2
Simoudis, E. (2000). If it's not one channel, then it's another. Bank Marketing, 32(1), 48-50+.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   2
Patent Cooperation Treaty, International Search Report & Written Opinion of the International Search Authority, PCT/US2009/055758, Oct. 29, 2010, 16 pages.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       2
Optical Society of America, Optics Express; vol. 12, No. 11. May 31, 2004, 7 Pages, Jeong, Ki-Hun , et al. “Tunable Microdoublet Lens Array”. DOI:10.1364/OPEX.12.002494 52 |  http://sharp-world.com/corporate/news/070831.html, Sharp Press Release, Aug. 31, 2007, 3 pages “Sharp Develops and Will Mass Produce New System LCD with Embedded Optical Sensors to Provide Input Capabilities Including Touch Screen and Scanner Functions”. |  Preumont, A. Vibration Control of Active Structures: An Introduction, Jul. 2011.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 2
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... 
International Search Report issued Aug. 23, 2010; PCT/DE2010/000420; Int'l File Date: Apr. 14, 2010; Earliest Priority: Apr. 14, 2009. |  Written Opinion for PCT/DE2010/000420; Int'l File Date: Apr. 14, 2010; Earliest Priority: Apr. 14, 2009; 7 pages. |  International Preliminary Report on Patentability issued Oct. 18, 2011 for PCT/DE2010/000420; Int'l File Date: Apr. 14, 2010; Earliest Priority: Apr. 14, 2009; 8 pages.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           1
International Preliminary Report on Patentability dated Jan. 17, 2012 in PCT/EP2010/059652. |  German Search Report dated Feb. 25, 2010 for DE 10 2009 033 538.2-34. |  European Search Report dated Mar. 29, 1989 for EP89810234. |  Japanese Office Action dated Nov. 19, 2013 in 2012-518970.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  1
Al-Lazikani B et al., “Standard conformations for the canonical structures of immunoglobulins.” J Mol Biol. Nov. 7, 1997;273(4):927-48. DOI:10.1006/jmbi.1997.1354 99 |  Balint RF, Larrick JW. “Antibody engineering by parsimonious mutagenesis.” Gene. Dec. 27, 1993;137(1):109-18. DOI:10.1016/0378-1119(93)90258-5 290 |  Boder ET and Wittrup KD., “Yeast surface display for screening combinatorial polypeptide libraries, ” Nat Biotechnol. Jun. 1997; 15(6):553-7. DOI:10.1038/nbt0697-553 300 |  Collis A et al., “Analysis of the Antigen Combining Site: Correlations Between Length and Sequence Composition of the Hypervariable Loops and the Nature of the Antigen, ” J Mol Biol 2003 325; 337-354. DOI:10.1016/S0022-2836(02)01222-6 9 |  Daugherty PS et al., “Analysis of the Antigen Combining Site: Correlations Between Length and Sequence Composition of the Hypervariable Loops and the Nature of the Antigen” Protein Eng. Sep. 1998; 11(9):825-32. DOI:10.1093/protein/11.9.825 47 |  De Bruin R et al., “Selection of high-affinity phage antibodies from phage display libraries, ” Nat Biotechnol Apr. 17, 1999: 397-399. 10 |  de Kruif J et al., “Selection and application of human single chain Fv antibody fragments from a semi-synthetic phage antibody display library with designed CDR3 regions, ” J Mol Biol. Apr. 21, 1995; 248(1):97-105. DOI:10.1006/jmbi.1995.0204 34 |  Ewert S et al., “Biophysical properties of human antibody variable domains, ” J Mol Biol. Jan. 17, 2003;325(3):531-53. DOI:10.1016/S0022-2836(02)01237-8 94 |  Hanes J and Plückthun A., “In vitro selection and evolution of functional proteins by using ribosome display, ” Proc Natl Acad Sci U S A. May 13, 1997;94(10):4937-42. DOI:10.1073/pnas.94.10.4937 330 |  Ivanov I et al., 2005, “Development of the Expressed Ig CDR-H3 Repertoire Is Marked by Focusing of Constraints in Length, Amino Acid Use, and Charge That Are First Established in Early B Cell Progenitors, ” J Immunol 174; 7773-7780. 6 |  Knappik A et al., “Fully synthetic human combinatorial antibody libraries (HuCAL) based on modular consensus frameworks and CDRs randomized with trinucleotides, ” J Mol Biol. Feb. 11, 2000;296(1):57-86. DOI:10.1006/jmbi.1999.3444 390 |  Lee CV et al., “High-affinity human antibodies from phage-displayed synthetic Fab libraries with a single framework scaffold, ” J Mol Biol. Jul. 23, 2004;340(5):1073-93. DOI:10.1016/j.jmb.2004.05.051 104 |  Lefranc, M.-P. et al., “IMGT, the international ImMunoGeneTics database, ” 1999 Nucleic Acids Research, 27, 209-212. DOI:10.1093/nar/27.1.209 38 |  Link JM et al., “Despite extensive similarity in germline DH and JH sequence, the adult Rhesus macaque CDR-H3 repertoire differs from human, ” Molecular Immunol. 2005 42; 943-955. DOI:10.1016/j.molimm.2004.09.027 1 |  Lu, “Seamless cloning and gene fusion, ” Trends in Biotechnology, 2005 vol. 23(4): 200-207. DOI:10.1016/j.tibtech.2005.02.008 3 |  Marks JD et al., “By-passing immunization. Human antibodies from V-gene libraries displayed on phage, ” J Mol Biol. Dec. 5, 1991;222(3):581-97. DOI:10.1016/0022-2836(91)90498-U 1138 |  Persson MA et al., “Generation of diverse high-affinity human monoclonal antibodies by repertoire cloning” Proc Natl Acad Sci U S A. Mar. 15, 1991;88(6):2432-6. DOI:10.1073/pnas.88.6.2432 97 |  Rock EP et al., “CDR3 Length in Antigen-specific Immune Receptors, ” J Exp Med 1994 179; 323-328. DOI:10.1084/jem.179.1.323 21 |  Rothe et al., “The human combinatorial antibody library HuCAL GOLD combines diversification of all six CDRs according to the natural immune system with a novel display method for efficient selection of high-affinity antibodies, ” J Mol Biol. Feb. 29, 2008;376(4):1182-200. DOI:10.1016/j.jmb.2007.12.018 35 |  Schoonbroodt S, et al., “Oligonucleotide-assisted cleavage and ligation: a novel directional DNA cloning technology to capture cDNAs. Application in the construction of a human immune antibody phage-display library” Nucleic Acids Res. May 19, 2005;33(9):e81. DOI:10.1093/nar/gni080  |  Schroeder Jr, HW et al., “Slow, programmed maturation of the immunoglobulin HCDR3 repertoire during the third trimester of fetal life, ” 2001 Blood 98; 2745-2751. DOI:10.1182/blood.V98.9.2745  |  Sidhu SS et al., “Phage-displayed antibody libraries of synthetic heavy chain complementarity determining regions, ” J Mol Biol. Apr. 23, 2004;338(2):299-310. DOI:10.1016/j.jmb.2004.02.050 82 |  Sidhu SS, et al., “Phage display for selection of novel binding peptides, ” Methods Enzymol. 2000;328:333-63. 90 |  Smith GP., “Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface, ” Science. Jun. 14, 1985;228(4705):1315-7. DOI:10.1126/science.4001944 386 |  Söderling E et al., “Recombining germline-derived CDR sequences for creating diverse single-framework antibody libraries, ” Nat Biotechnol. Aug. 2000; 18(8):852-6. DOI:10.1038/78458 87 |  Szybalski et al., “Class-IIS Restriction Enzymes—a Review.” Gene, vol. 100: 13-26 (1991). DOI:10.1016/0378-1119(91)90345-C  |  Zemlin M et al., “Expressed murine and human CDR-H3 intervals of equal length exhibit distinct repertoires that differ in their amino acid composition and predicted range of structures, ” 2003 J Mol Biol 334; 733-749. DOI:10.1016/j.jmb.2003.10.007  |  Fagete et al., “Specificity tuning of antibody fragments to neutralize two human chemokines with a single agent, ” mAbs, vol. 1(3): 288-296 (2009).                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 1
Yehuda Lindell et al; A Proof of Security of Yaoa s Protocol for Two-Party Computation; Journal of Cryptology; Dec. 9, 2008; pp. 161-188; vol. 22, No. 2; Springe-Verlag, NE. |  Jarvinen, Kolesnikov, Sadeghi, Schneider; Embedded SFE: Offloading Server and Network using Hardware Tokens; Lecture Notes on Computer Science; Jan. 28, 2010; pp. 207-221. 11 |  XP002598720 Heidelberg Lecture Notes on Computer Science Retrieved from the Internet: URL:http://eprint.iacr.org/2009/591.pdf.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 1
Arendt, Th. et al., “Neuroprotection by Repressing G0-G1 Transition: A Therapeutic Strategy for AD?” Eur. J. Neuroscience 12(Supplement 11):552 TWH 4 (2000). 5 |  Chyan, C.J. et al., “Neuroprotective Activity of Melatonin Against Alzheimer Beta-Amyloid is Not Mediated by Melatonin Receptors”, Society of Neuroscience Abstracts, vol. 24(1/2):1455 (1998). |  Copani, A., et al., “Mitotic Signaling by Beta-Amyloid Causes Neuronal Death, ” FASEB J. 13/15:2225-2234, (1999). 12 |  Crapper Mclachlan, D.R. et al., “Intramuscular Desferrioxamine in Patients With Alzheimer's Disease, ” The Lancet 337(8573):1304-1308, (1991). DOI:10.1016/0140-6736(91)92978-B 22 |  Database WPI Week 199744, Derwent, AN 1997-475453 & JP 09 221421 (Kyowa Hakko Kogyo KK) (Aug. 26, 1997). |  Database WPI Week 200114, Derwent, AN 2001-127322 & JP 2000 290184 (Kyowa Hakko Kogyo KK) (Oct. 17, 2000). |  European Search Report EP 06025392 (Jun. 13, 2007) pp. 1-23. |  European Search Report EP 06025393 (Apr. 26, 2007) pp. 1-12. |  European Search Report EP 06025394 (May 30, 3007) pp. 1-8. |  Giovanni, A. “Involvement of Cell Cycle Elements, Cyclin-dependent Kinases, pRv, and E2F.DP, in B-amyloid-induced Neuronal Death, ” J. Biol. Chem. 274(27):19011-19016 (1999). DOI:10.1074/jbc.274.27.19011 3 |  Giovanni, A “E2F1 Mediates Death of B-amyloid-treated Cortical Neurons in a Manner Independent of p53 and Dependent on Bax and Caspase 3”, J. Biol. Chem. 275(16):11553-11560, (2000). DOI:10.1074/jbc.275.16.11553 4 |  Howlett, D.R., “Common Structural Features Determine the Effectiveness of Carvedilo, Daunomycin and Rolitetracycline As Inhibitors of Alzeheimer B-Amyloid Fibril Formation, ” Biochem. J. 343, pp. 419-423, 1999. DOI:10.1042/0264-6021:3430419 7 |  Israel, C.W. et al., “Discrimination Between Ventricular and Supraventricular Tachycardia by Dual Chamber Cardioverter Defibrillators: Importance of the Atrial Sensing Function, ”J. Pacing and Clinical Electrophysiology, 24(2):183-190, 2001. DOI:10.1046/j.1460-9592.2001.00183.x  |  Janicki, S.M. et. al., “Presenilin Overexpression Arrests Cells in the G1 Phase of the Cell Cycle, Arrest Potentiated by the Alzheimer's Disease PS2(N1411) Mutant, ” Amer. J. Pathology 155(1):135-144, (1999). DOI:10.1016/S0002-9440(10)65108-5 6 |  Kwada, M. et al., “A Novel Antitumor Compound, Reduces Cyclin D1 Levels, Arrests Cell Cycle At G1 Phase, and Inhibits Anchorage-Independent Growth of Human Tumor Cells, ” Exper. Cell. Res. 249(2), 240-247, (1999). DOI:10.1006/excr.1999.4467  |  Lazarovici, P. et al., “K252a and Staurosoporine Microbial Alkaloid Toxins As Prototype of Neurotropic Drugs, ” Advances in Experimental Medicine & Biology, 391(31):367-377, (1996).  |  Liu, D.X. et al., “Neuronal apoptosis at the GI/S cell cycle checkpoint, ” Cell Tissue Res., 305:217-228, (2001). DOI:10.1007/s004410100396  |  Nagy, Z. et al., “Cell Cycle Markers in the Hippocampus in Alzheimer's Disease, ” Acta Neuropathol. 94:6-15 (1997).  |  Nagy, Z., et al., “Expression of Cell Division Markers in the Hippocampus in Alzheimer's Disease and Other Neurodegenerative Conditions, ” Acta Neuropathol. 93:294-300 (1997).  |  Nagy, Z., et al., “The Cell Division Cycle and the Pathophysiology of Alzheimer's Disease, ” Neuroscience 87(4):731-739 (1998). 10 |  Nagy, Z. et al., “Cell Cycle Regulation in Alzheimer's Disease, ” Eur. J. Neuroscience 12(Supplement 11):552 TWH 3 (2000). |  Nagy, Z. “Cell Cycle Regulatory Failure in Neurones: Causes and Consequences, ” Neurobiology of Aging 21:761-769 (2000). DOI:10.1016/S0197-4580(00)00223-2  |  Nagy, Z. et al., “Cell Cycle Kinesis in Lymphocytes in the Diagnosis of Alzheimer's Disease, ” Neuroscience Lett. 317:81-84 (2002). DOI:10.1016/S0304-3940(01)02442-9  |  Nagy, Z. “The Last Neuronal Division: A Unifying Hypothesis for the Pathogenesis of Alzheimer's Disease, ” J. Cell. Mol. Biol. 9(3):531-541 (2005). DOI:10.1111/j.1582-4934.2005.tb00485.x 1 |  Nagy, Z. “The Dysregulation of the Cell Cycle and the Diagnosis of Alzheimer's Disease, ” Biochimica Biophs. Acta 1772:402-408 (2007). DOI:10.1016/j.bbadis.2006.11.001 2 |  Nakai, M. et al., “PKC and Tyrosine Kinase Involvement in Amyloid (25-35)-Induced Chemotaxis of Microglia, ” Neuroreport Rapid Communications of Oxford 9(15):467-3470, (1998). DOI:10.1097/00001756-199810260-00024  |  Nitsch, R.M. “Vasopressin and Bradykinin Regulate Secretory Processing of the Amyloid Protein Precursor of Alzheimer's Disease, ” Neurochemical Research 23(5):807-814, (1998). DOI:10.1023/A:1022423813362  |  Pappolla, M.A. “Melatonin Prevents Death of Neuroblastoma Cells Exposed to the Alzheimer Amyloid Peptide, ” J. Neuroscience 17(5):1683-1690, (1997).  |  Racchi, M. et al., “Bradykinin-Induced Amyloid Precursor Protein Secretion in Fibroblasts from Alzheimer's Disease Down's Syndrome and Control Donors”, Society of Neuroscience Abstracts, 22(1-3):1944 (1996). |  Regenold, W.T., “Uses of Intravenous Valproate in Geriatric Psychiatry, ” Am J. Geriatric Psychiatry, 9(3):306-308, (2001). DOI:10.1176/appi.ajgp.9.3.306  |  Sival, R.C. et al., “The Effects of Sodium Valproate on Disturbed Behavior in Dementia”, J. Amer. Geriatrics Soc. 42(8):906-907 (1994).  |  Takahashi, M. et al., “Shorei Hokoku Valproic Acid Natrium . . . , ” Brain and Nerve, 48(8):757-760 (1996). |  Nagy, Z. (2007) “The Dysregulation of the Cell Cycle and the Diagnosis of Alzheimer's Disease, ” Biochimica et Biophysica Acta 1772:402-408. DOI:10.1016/j.bbadis.2006.11.001  |  Ueberham, U. et al. (2005) “The Expression of Cell Cycle Proteins in Neurons and its Relevance for Alzheimer's Disease, ” CNS & Neurological Disorders 4:293-306. |  Wang, Z. et al. (2014) “Valproic Acid Reduces Neuritic Plaque Formation and Improves Learning Deficits in APPSwe/PSIA246E Transgenic Mice via Preventing the Prenatal Hypoxia-Induced Down-Regulation of Neprilysin, ” CNS Neuroscience & Therapeutics 20:209-217. DOI:10.1111/cns.12186  |  Zhang, X.-Z. et al. (2010) “Valproic Acid As a Promising Agent to Combat Alzheimer's Disease, ” Brain Research Bulletin 81:3-6. DOI:10.1016/j.brainresbull.2009.09.003      1
Name: Cited Refs - Non-patent, Length: 1870, dtype: int64


Citing Patents
Not available                                                                                                               741
US10478364B2 | US9951904B2                                                                                                    3
US20120319729A1                                                                                                               2
US11174288B2                                                                                                                  2
US10107982B2 | US20180143392A1                                                                                                1
                                                                                                                           ... 
RU190690U1 | US20130093149A1 | US9193045B2                                                                                    1
US10245093B2 | US11607259B2 | US20120330368A1                                                                                 1
US10927939B1 | US11162570B2                                                                                                   1
USD743051S1                                                                                                                   1
US10188528B2 | US10350088B2 | US10398574B2 | US20150182264A1 | US20170196596A1 | US9549766B2 | US9763699B2 | US9987044B2      1
Name: Citing Patents, Length: 2040, dtype: int64


INPADOC Legal Status
2019-02-26 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2018-12-30 |  2019-02-04 STCH INFORMATION ON STATUS: PATENT DISCONTINUATION - PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 |  2019-02-04 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY |  2018-08-13 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  30
2019-02-26 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2018-12-30 |  2019-02-04 STCH INFORMATION ON STATUS: PATENT DISCONTINUATION - PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 |  2019-02-04 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY |  2018-08-13 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  14
2022-06-30 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY FEE PAYMENT YEAR 8 |  2018-07-02 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 |  2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   12
2022-06-15 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY FEE PAYMENT YEAR 8 |  2018-06-14 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 |  2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   12
2019-02-26 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2018-12-30 |  2019-02-04 STCH INFORMATION ON STATUS: PATENT DISCONTINUATION - PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 |  2019-02-04 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: MICROENTITY |  2018-08-13 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: MICROENTITY                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    10
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ..
2022-06-14 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY FEE PAYMENT YEAR 8 |  2018-06-26 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 |  2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE |  2011-01-10 AS ASSIGNMENT AESCULAP AG, GERMANY ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:SCHWEITZER, TOM;MAYENBERGER, RUPERT;REEL/FRAME:025642/0388 2010-12-01                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  1
2023-02-28 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2022-12-30 |  2023-02-06 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY |  2022-08-22 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY |  2018-05-30 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 |  2016-12-09 AS ASSIGNMENT SAFRAN NACELLES, FRANCE CHANGE OF NAME;ASSIGNOR:AIRCELLE;REEL/FRAME:040700/0466 2016-06-13 |  2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE |  2013-05-07 AS ASSIGNMENT AIRCELLE, FRANCE ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:VAUCHEL, GUY BERNARD;JORET, JEAN-PHILIPPE;LE BOULICAUT, LOIC;AND OTHERS;SIGNING DATES FROM 20121108 TO 20121114;REEL/FRAME:030364/0428                                                                                                                   1
2023-02-28 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2022-12-30 |  2023-02-06 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY |  2022-08-22 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY |  2018-05-28 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 |  2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE |  2012-12-21 AS ASSIGNMENT KSB S.A.S., FRANCE ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:DUBOY, DOMINIQUE;AMAGAT, CHRISTOPHE;REEL/FRAME:029518/0523 2012-12-12                                                                                                                                                                                                                                                                                                         1
2022-05-19 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY FEE PAYMENT YEAR 8 |  2018-06-14 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 |  2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE |  2012-04-13 AS ASSIGNMENT 3M INNOVATIVE PROPERTIES COMPANY, MINNESOTA ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:WHEATLEY, JOHN A.;LIU, TAO;HAO, ENCAI;AND OTHERS;SIGNING DATES FROM 20120319 TO 20120402;REEL/FRAME:028046/0389                                                                                                                                                                                                                                                                                                                                                                                                                                                                 1
2019-02-26 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2018-12-30 |  2019-02-04 STCH INFORMATION ON STATUS: PATENT DISCONTINUATION - PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 |  2019-02-04 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY |  2018-08-13 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY |  2016-08-02 AS ASSIGNMENT OXFORD UNIVERSITY INNOVATION LIMITED, GREAT BRITAI CHANGE OF NAME;ASSIGNOR:ISIS INNOVATION LIMITED;REEL/FRAME:039550/0045 2016-06-16 |  2016-08-02 AS ASSIGNMENT OXFORD UNIVERSITY INNOVATION LIMITED, GREAT BRITAIN CHANGE OF NAME;ASSIGNOR:ISIS INNOVATION LIMITED;REEL/FRAME:039550/0045 2016-06-16 |  2015-04-21 CC CERTIFICATE OF CORRECTION |  2014-11-21 AS ASSIGNMENT ISIS INNOVATION LIMITED, UNITED KINGDOM ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:NAGY, ZSUZSANNA;REEL/FRAME:034232/0725 2002-09-05     1
Name: INPADOC Legal Status, Length: 2681, dtype: int64


INPADOC Family Members
US8919357B2 | CN102029266A | CN102029266B | CN201625643U | JP03160354U | US20110073135A1 | US20130160803A1 | WO2011037744A2 | WO2011037744A3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  1
US8921157B2 | CN102695373A | CN102695373B | JP05662855B2 | JP2012204570A | KR1391346B1 | KR2012108938A | US20120244666A1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      1
US8919110B2 | BR112012015467A2 | BR112012015467B1 | BRPI1013395A2 | BRPI1013395B1 | BRPI1013401A2 | BRPI1013401B1 | CN102333579A | CN102413906A | CN102762283A | CN105642116A | CN105642116B | CN105909349A | CN107654273A | CN110030064A | CN110043350A | DE102010002425A1 | DE102010002425B4 | DE102010056223A1 | DE202010018079U1 | DE202010018081U1 | EP2401056A1 | EP2401056B1 | EP2401059A1 | EP2401059B1 | EP2516044A1 | EP2516044B1 | EP2589427A2 | EP2589427A3 | EP2589427B1 | EP2750783A1 | EP3320964A1 | EP3372301A1 | EP3777998A1 | GB200903262D0 | GB200922612D0 | GB201003244D0 | GB201014027D0 | GB201021957D0 | GB201118038D0 | GB201204258D0 | GB201301760D0 | GB201301761D0 | GB201301893D0 | GB2468210A | GB2468210B | GB2476585A | GB2476585B | GB2485260A | GB2485260B | GB2487850A | GB2487850B | GB2497440A | GB2497440B | GB2497441A | GB2497441B | GB2497442A | GB2497442B | JP05717654B2 | JP05876727B2 | JP06687666B2 | JP2012518537A | JP2012518753A | JP2013515902A | JP2017006904A | JP2018159380A | KR1718574B1 | KR1833549B1 | KR1899919B1 | KR1945677B1 | KR2011119748A | KR2011127225A | KR2012113234A | KR2018021243A | KR2018104189A | KR2072505B1 | RU2011139081A | RU2011139134A | RU2012131517A | RU2527462C2 | RU2529532C2 | RU2548997C2 | US20100239478A1 | US20110158871A1 | US20120097033A1 | US20120107203A1 | US20130330259A1 | US20140186228A1 | US20150093300A1 | US20160193594A1 | US20180361364A1 | US8012439B2 | US8211393B2 | US8512657B2 | US8608820B2 | US9261004B2 | US9415344B2 | WO2010097634A1 | WO2010097638A1 | WO2011077168A1 | WO2013030584A1    1
US8920467B2 | CN102791226A | CN102791226B | EP2572685A1 | EP2572685A4 | EP2572685B1 | HK1175390A1 | JP05462280B2 | JP2012124175A1 | KR2013127561A | TW201236668A | TWI507186B | US20130030464A1 | WO2012124175A1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1
US8922204B2 | DE102012204514A1 | DE102012204514B4 | JP2012202861A | US20120242330A1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           1
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ..
US8921297B2 | AR82717A1 | CA2806329A1 | CA2806329C | EP2420558A1 | EP2420558B1 | ES2643613T3 | JP05727612B2 | JP2013537580A | MX2013001904A | MX369460B | PL2420558T3 | RU2013101986A | RU2552622C2 | US20120046214A1 | WO2012024076A1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        1
US8921364B2 | AU2010304740A1 | AU2010304740B2 | BR112012008209A2 | BR112012008209B1 | CA2776842A1 | CA2776842C | CA2784277A1 | CA2784277C | CA3012610A1 | CL2012000883A1 | CN102834382A | CN102834382B | CN102958925A | CN102958925B | CN104788430A | CN104788430B | CN110627724A | CO6551740A2 | CY1120387T1 | CY1120442T1 | DK2509955T3 | DK2509974T3 | EA201290138A1 | EA201290139A1 | EA24630B1 | EA24630B9 | EA25302B1 | EA25302B8 | EP2509955A1 | EP2509955B1 | EP2509974A1 | EP2509974B1 | EP3299361A1 | ES2676317T3 | ES2677043T3 | HK1253000A1 | HRP20181014T1 | HRP20181076T1 | HUE038763T2 | HUE039261T2 | IL219192A0 | IL219192A | IL253000A0 | IL253000B | JP05749725B2 | JP05909312B2 | JP06266568B2 | JP2013507350A | JP2013507351A | JP2016028037A | JP2018080176A | KR1750965B1 | KR1887599B1 | KR2012088738A | KR2017072957A | LT2509955T | LT2509974T | MX2012004210A | NZ599507A | PL2509955T3 | PL2509974T3 | PT2509955T | PT2509974T | RS57441B1 | RS57523B1 | SG10201803845A1 | SI2509955T1 | SI2509974T1 | TR201809711T4 | TR201810009T4 | US10174034B2 | US10246450B2 | US10668051B2 | US20110105447A1 | US20110112058A1 | US20130310377A1 | US20150166526A1 | US20150291588A1 | US20170313690A1 | US20180222898A1 | US20190160046A1 | US20190248791A1 | US8377970B2 | US8993612B2 | US9758514B2 | US9944631B2 | WO2011042797A1 | WO2011042797A4 | WO2011042798A1 | ZA201202921B                                                                                                                                                                                                     1
US8921060B2 | AU2010318218A1 | AU2010318218B2 | BR112012011099A2 | CA2780032A1 | CN102595937A | EP2498627A1 | EP2498627B1 | ES2497569T3 | JP2013510108A | KR2012112452A | RU2012123719A | RU2544969C2 | TW201138649A | US20120230923A1 | WO2011057872A1 | ZA201204133B                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        1
US8921502B2 | CN102933613A | CN102933613B | EP2516478A1 | EP2516478B1 | PL2516478T3 | TW201134837A | US20130202830A1 | WO2011076377A1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         1
US8921321B2 | AT481093T | AT524169T | AT535236T | DE60237725D1 | EP1408938A1 | EP1764092A2 | EP1764092A3 | EP1764092B1 | EP1767197A2 | EP1767197A3 | EP1767197B1 | EP1769791A2 | EP1769791A3 | EP1769791B1 | EP2286803A1 | EP2286875A1 | EP2289511A1 | EP2292238A1 | EP2292240A1 | ES2352964T3 | ES2373565T3 | ES2375293T3 | GB200117645D0 | US20030032673A1 | US20130102553A1 | US8343926B2 | WO2003007925A1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 1
Name: INPADOC Family Members, Length: 2784, dtype: int64


INPADOC Family ID
20070425IT2006MI1910A1     3
20130502US20130105674A1    3
20120329WO2012040302A1     3
20090820AU2009214990A1     2
20051218IL164591A0         2
                          ..
20110113WO2011005477A1     1
20110113WO2011006154A1     1
20110421WO2011045712A1     1
20120222EP2420558A1        1
20010912GB200117645D0      1
Name: INPADOC Family ID, Length: 2770, dtype: int64


In [22]:
df['Publication Kind Code'].unique()
Out[22]:
array(['B2', 'B1'], dtype=object)
In [23]:
df['Publication Kind Code'].value_counts()
Out[23]:
B2    2554
B1     230
Name: Publication Kind Code, dtype: int64
In [24]:
plt.figure(figsize=(15,6))
sns.countplot(df['Publication Kind Code'], data = df, palette = 'hls')
plt.show()
In [25]:
plt.figure(figsize=(30,20)) 
plt.pie(df['Publication Kind Code'].value_counts(), labels=df['Publication Kind Code'].value_counts().index, autopct='%1.1f%%', textprops={ 'fontsize': 25,
                                           'color': 'black',
                                           'weight': 'bold',
                                           'family': 'serif' }) 
hfont = {'fontname':'serif', 'weight': 'bold'}
plt.title('Publication Kind Code', size=20, **hfont) 
plt.show()
In [26]:
for i in num_cols:
    plt.figure(figsize=(15,6))
    sns.histplot(df[i], kde = True, bins = 20, palette = 'hls')
    plt.xticks(rotation = 90)
    plt.show()
In [27]:
for i in num_cols:
    plt.figure(figsize=(15,6))
    sns.distplot(df[i], kde = True, bins = 20)
    plt.xticks(rotation = 90)
    plt.show()
In [28]:
for i in num_cols:
    plt.figure(figsize=(15,6))
    sns.boxplot(df[i], data = df, palette = 'hls')
    plt.xticks(rotation = 90)
    plt.show()
In [29]:
for i in num_cols:
    plt.figure(figsize=(15,6))
    sns.violinplot(df[i], data = df, palette = 'hls')
    plt.xticks(rotation = 90)
    plt.show()
In [30]:
for i in num_cols:
    for j in num_cols:
        if i != j:
            plt.figure(figsize=(15,6))
            sns.lineplot(x = df[i], y = df[j], data = df, palette = 'hls')
            plt.xticks(rotation = 90)
            plt.show()
In [31]:
for i in num_cols:
    for j in num_cols:
        if i != j:
            plt.figure(figsize=(15,6))
            sns.scatterplot(x = df[i], y = df[j], data = df, palette = 'hls')
            plt.xticks(rotation = 90)
            plt.show()
In [32]:
for i in num_cols:
    plt.figure(figsize=(15,6))
    sns.barplot(x = df['Publication Kind Code'], y = df[i], data = df, ci = None, palette = 'hls')
    plt.xticks(rotation = 90)
    plt.show()
In [33]:
df['application_date_'] = pd.to_datetime(df['Application Date'], format='%Y-%m-%d')
In [34]:
df['publication_date_'] = pd.to_datetime(df['Publication Date'], format='%Y-%m-%d')
In [35]:
df['duration'] = df['publication_date_']  - df['application_date_']
In [36]:
df.head()
Out[36]:
Publication Number Title Priority Number Priority Date Application Number Application Date Publication Kind Code Publication Date Inventor - w/address Assignee/Applicant ... Cited Refs - Non-patent Count of Cited Refs - Non-patent Citing Patents Count of Citing Patents INPADOC Legal Status INPADOC Family Members INPADOC Family ID application_date_ publication_date_ duration
0 US8919357B2 Steam appliance US2009567718A 2009-09-25 US13653717A 2012-10-17 B2 2014-12-30 Breit Oliver Rudolph|Mid Levels, HK Euro-Pro Operating LLC,Newton,MA,US ... Evaluation Report for Chinese Application No. ... 6 US20160128536A1 | US20160128537A1 | US9549651B... 5 2022-06-30 MAFP MAINTENANCE FEE PAYMENT + PAYM... US8919357B2 | CN102029266A | CN102029266B | CN... 20100624JP03160354U_ 2012-10-17 2014-12-30 804 days
1 US8920125B2 Dual frequency hub mounted vibration suppresso... US200870097P | US2009353217A 2008-03-20 | 2009-01-13 US13774011A 2013-02-22 B2 2014-12-30 Welsh William A.|North Haven, CT, US Sikorsky Aircraft Corporation,Stratford,CT,US ... Kayler, Kimberly. “LORD Corporation's Technolo... 3 US10167079B2 | US10308355B2 | US10400851B2 | U... 23 2022-06-30 MAFP MAINTENANCE FEE PAYMENT + PAYM... US8920125B2 | US20090236468A1 | US20130164132A... 20090924US20090236468A1 2013-02-22 2014-12-30 676 days
2 US8920781B2 Carrier particles for use in dry powder inhalers GB19951841A | GB199521937A | WO1996GB215A | US... 1995-01-31 | 1995-10-26 | 1996-01-31 | 1997-09... US2010748275A 2010-03-26 B2 2014-12-30 Staniforth John Nicholas|Bath, GB Vectura Limited,Chippenham, Wiltshire,GB | Sta... ... Ahmed “Particle Interactions in Multicomponent... 13 US10561613B2 | US20160243039A1 | WO2022047047A1 3 2019-02-26 FP LAPSED DUE TO FAILURE TO PAY MAI... US8920781B2 | AT256450T | AT355822T | AT526946... 19950322GB199501841D0 2010-03-26 2014-12-30 1740 days
3 US8921104B2 Method for producing dendritic cells GB199824306A | WO1999GB3653A | US2001849499A |... 1998-11-05 | 1999-11-05 | 2001-05-04 | 2007-04... US13538995A 2012-06-29 B2 2014-12-30 Waldmann Herman|Oxford, GB | Fairchild Paul J.... ISIS Innovation Limited,Oxford,GB | Waldmann H... ... Brossart et al. Virus-mediated delivery of ant... 22 US11020465B2 1 2023-02-28 FP LAPSED DUE TO FAILURE TO PAY MAI... US8921104B2 | AU200010584A | AU768267B2 | CA23... 19981230GB199824306D0 2012-06-29 2014-12-30 914 days
4 US8923511B2 Enciphering apparatus and method, deciphering ... JP1997106136A | US199859776A | US2001872509A |... 1997-04-23 | 1998-04-14 | 2001-06-01 | 2006-02... US13899054A 2013-05-21 B2 2014-12-30 Ishiguro Ryuji|Tokyo, JP | Osawa Yoshitomo|Kan... Sony Corporation,Tokyo,JP ... Schneier Bruce: “Applied Cryptography Second E... 18 US20150381359A1 | US9467287B2 2 2021-11-04 AS ASSIGNMENT REDWOOD TECHNOLOGIES,... US8923511B2 | CN100418317C | CN1190033C | CN12... 19981029ID20227A_ 2013-05-21 2014-12-30 588 days

5 rows × 55 columns

In [37]:
df.info()
<class 'pandas.core.frame.DataFrame'>
RangeIndex: 2784 entries, 0 to 2783
Data columns (total 55 columns):
 #   Column                                  Non-Null Count  Dtype          
---  ------                                  --------------  -----          
 0   Publication Number                      2784 non-null   object         
 1   Title                                   2784 non-null   object         
 2   Priority Number                         2784 non-null   object         
 3   Priority Date                           2784 non-null   object         
 4   Application Number                      2784 non-null   object         
 5   Application Date                        2784 non-null   object         
 6   Publication Kind Code                   2784 non-null   object         
 7   Publication Date                        2784 non-null   object         
 8   Inventor - w/address                    2784 non-null   object         
 9   Assignee/Applicant                      2784 non-null   object         
 10  Assignee - Current US                   2784 non-null   object         
 11  DWPI Class                              2784 non-null   object         
 12  DWPI Manual Codes                       2784 non-null   object         
 13  IPC - Current                           2784 non-null   object         
 14  CPC - Current                           2784 non-null   object         
 15  US Class                                2784 non-null   object         
 16  Abstract                                2784 non-null   object         
 17  Title (Original language)               2784 non-null   object         
 18  Claims                                  2784 non-null   object         
 19  Claims Count                            2784 non-null   int64          
 20  First Claim                             2784 non-null   object         
 21  Independent Claims                      2784 non-null   object         
 22  Description                             2784 non-null   object         
 23  Assignee/Applicant (Original Language)  2784 non-null   object         
 24  Assignee - Original                     2784 non-null   object         
 25  Optimized Assignee                      2784 non-null   object         
 26  Ultimate Parent                         2784 non-null   object         
 27  Inventor                                2784 non-null   object         
 28  Inventor Count                          2784 non-null   int64          
 29  Attorney/Agent                          2784 non-null   object         
 30  Examiner                                2784 non-null   object         
 31  Publication Country Code                2784 non-null   object         
 32  Dead/Alive                              2784 non-null   object         
 33  Publication Month                       2784 non-null   int64          
 34  Publication Year                        2784 non-null   int64          
 35  Application Country/Region              2784 non-null   object         
 36  Application Month                       2784 non-null   int64          
 37  Application Year                        2784 non-null   int64          
 38  Priority Date - Earliest                2784 non-null   object         
 39  Earliest Priority Year                  2784 non-null   int64          
 40  IPC Class                               2784 non-null   object         
 41  CPC Class                               2784 non-null   object         
 42  US Class - Original                     2784 non-null   object         
 43  Cited Refs - Patent                     2778 non-null   object         
 44  Count of Cited Refs - Patent            2784 non-null   int64          
 45  Cited Refs - Non-patent                 2784 non-null   object         
 46  Count of Cited Refs - Non-patent        2784 non-null   int64          
 47  Citing Patents                          2784 non-null   object         
 48  Count of Citing Patents                 2784 non-null   int64          
 49  INPADOC Legal Status                    2784 non-null   object         
 50  INPADOC Family Members                  2784 non-null   object         
 51  INPADOC Family ID                       2784 non-null   object         
 52  application_date_                       2784 non-null   datetime64[ns] 
 53  publication_date_                       2784 non-null   datetime64[ns] 
 54  duration                                2784 non-null   timedelta64[ns]
dtypes: datetime64[ns](2), int64(10), object(42), timedelta64[ns](1)
memory usage: 1.2+ MB
In [38]:
df['duration_days'] = df['duration'].dt.days
In [39]:
df.head()
Out[39]:
Publication Number Title Priority Number Priority Date Application Number Application Date Publication Kind Code Publication Date Inventor - w/address Assignee/Applicant ... Count of Cited Refs - Non-patent Citing Patents Count of Citing Patents INPADOC Legal Status INPADOC Family Members INPADOC Family ID application_date_ publication_date_ duration duration_days
0 US8919357B2 Steam appliance US2009567718A 2009-09-25 US13653717A 2012-10-17 B2 2014-12-30 Breit Oliver Rudolph|Mid Levels, HK Euro-Pro Operating LLC,Newton,MA,US ... 6 US20160128536A1 | US20160128537A1 | US9549651B... 5 2022-06-30 MAFP MAINTENANCE FEE PAYMENT + PAYM... US8919357B2 | CN102029266A | CN102029266B | CN... 20100624JP03160354U_ 2012-10-17 2014-12-30 804 days 804
1 US8920125B2 Dual frequency hub mounted vibration suppresso... US200870097P | US2009353217A 2008-03-20 | 2009-01-13 US13774011A 2013-02-22 B2 2014-12-30 Welsh William A.|North Haven, CT, US Sikorsky Aircraft Corporation,Stratford,CT,US ... 3 US10167079B2 | US10308355B2 | US10400851B2 | U... 23 2022-06-30 MAFP MAINTENANCE FEE PAYMENT + PAYM... US8920125B2 | US20090236468A1 | US20130164132A... 20090924US20090236468A1 2013-02-22 2014-12-30 676 days 676
2 US8920781B2 Carrier particles for use in dry powder inhalers GB19951841A | GB199521937A | WO1996GB215A | US... 1995-01-31 | 1995-10-26 | 1996-01-31 | 1997-09... US2010748275A 2010-03-26 B2 2014-12-30 Staniforth John Nicholas|Bath, GB Vectura Limited,Chippenham, Wiltshire,GB | Sta... ... 13 US10561613B2 | US20160243039A1 | WO2022047047A1 3 2019-02-26 FP LAPSED DUE TO FAILURE TO PAY MAI... US8920781B2 | AT256450T | AT355822T | AT526946... 19950322GB199501841D0 2010-03-26 2014-12-30 1740 days 1740
3 US8921104B2 Method for producing dendritic cells GB199824306A | WO1999GB3653A | US2001849499A |... 1998-11-05 | 1999-11-05 | 2001-05-04 | 2007-04... US13538995A 2012-06-29 B2 2014-12-30 Waldmann Herman|Oxford, GB | Fairchild Paul J.... ISIS Innovation Limited,Oxford,GB | Waldmann H... ... 22 US11020465B2 1 2023-02-28 FP LAPSED DUE TO FAILURE TO PAY MAI... US8921104B2 | AU200010584A | AU768267B2 | CA23... 19981230GB199824306D0 2012-06-29 2014-12-30 914 days 914
4 US8923511B2 Enciphering apparatus and method, deciphering ... JP1997106136A | US199859776A | US2001872509A |... 1997-04-23 | 1998-04-14 | 2001-06-01 | 2006-02... US13899054A 2013-05-21 B2 2014-12-30 Ishiguro Ryuji|Tokyo, JP | Osawa Yoshitomo|Kan... Sony Corporation,Tokyo,JP ... 18 US20150381359A1 | US9467287B2 2 2021-11-04 AS ASSIGNMENT REDWOOD TECHNOLOGIES,... US8923511B2 | CN100418317C | CN1190033C | CN12... 19981029ID20227A_ 2013-05-21 2014-12-30 588 days 588

5 rows × 56 columns

In [40]:
df.info()
<class 'pandas.core.frame.DataFrame'>
RangeIndex: 2784 entries, 0 to 2783
Data columns (total 56 columns):
 #   Column                                  Non-Null Count  Dtype          
---  ------                                  --------------  -----          
 0   Publication Number                      2784 non-null   object         
 1   Title                                   2784 non-null   object         
 2   Priority Number                         2784 non-null   object         
 3   Priority Date                           2784 non-null   object         
 4   Application Number                      2784 non-null   object         
 5   Application Date                        2784 non-null   object         
 6   Publication Kind Code                   2784 non-null   object         
 7   Publication Date                        2784 non-null   object         
 8   Inventor - w/address                    2784 non-null   object         
 9   Assignee/Applicant                      2784 non-null   object         
 10  Assignee - Current US                   2784 non-null   object         
 11  DWPI Class                              2784 non-null   object         
 12  DWPI Manual Codes                       2784 non-null   object         
 13  IPC - Current                           2784 non-null   object         
 14  CPC - Current                           2784 non-null   object         
 15  US Class                                2784 non-null   object         
 16  Abstract                                2784 non-null   object         
 17  Title (Original language)               2784 non-null   object         
 18  Claims                                  2784 non-null   object         
 19  Claims Count                            2784 non-null   int64          
 20  First Claim                             2784 non-null   object         
 21  Independent Claims                      2784 non-null   object         
 22  Description                             2784 non-null   object         
 23  Assignee/Applicant (Original Language)  2784 non-null   object         
 24  Assignee - Original                     2784 non-null   object         
 25  Optimized Assignee                      2784 non-null   object         
 26  Ultimate Parent                         2784 non-null   object         
 27  Inventor                                2784 non-null   object         
 28  Inventor Count                          2784 non-null   int64          
 29  Attorney/Agent                          2784 non-null   object         
 30  Examiner                                2784 non-null   object         
 31  Publication Country Code                2784 non-null   object         
 32  Dead/Alive                              2784 non-null   object         
 33  Publication Month                       2784 non-null   int64          
 34  Publication Year                        2784 non-null   int64          
 35  Application Country/Region              2784 non-null   object         
 36  Application Month                       2784 non-null   int64          
 37  Application Year                        2784 non-null   int64          
 38  Priority Date - Earliest                2784 non-null   object         
 39  Earliest Priority Year                  2784 non-null   int64          
 40  IPC Class                               2784 non-null   object         
 41  CPC Class                               2784 non-null   object         
 42  US Class - Original                     2784 non-null   object         
 43  Cited Refs - Patent                     2778 non-null   object         
 44  Count of Cited Refs - Patent            2784 non-null   int64          
 45  Cited Refs - Non-patent                 2784 non-null   object         
 46  Count of Cited Refs - Non-patent        2784 non-null   int64          
 47  Citing Patents                          2784 non-null   object         
 48  Count of Citing Patents                 2784 non-null   int64          
 49  INPADOC Legal Status                    2784 non-null   object         
 50  INPADOC Family Members                  2784 non-null   object         
 51  INPADOC Family ID                       2784 non-null   object         
 52  application_date_                       2784 non-null   datetime64[ns] 
 53  publication_date_                       2784 non-null   datetime64[ns] 
 54  duration                                2784 non-null   timedelta64[ns]
 55  duration_days                           2784 non-null   int64          
dtypes: datetime64[ns](2), int64(11), object(42), timedelta64[ns](1)
memory usage: 1.2+ MB

Analysis Summary¶

  1. Clearly the average number of claims that was made is around 25 to 30, in very few scenarios the claims count has crossed 100.
  2. The inventor count in most of the patent application is two and 4 being the second highest inventor count.
  3. From the graph it is obvious that the month that has seen the highest number of application is March and December with the rest of the months sharing almost the same number of applications.
  4. For this study we have taken the patent applications that were approved in the year 2014. From the graph it is clear that most of the patent were filed in the year 2013.
  5. Most of the patents has their earliest priority year as 2010 and 2011.
  6. Almost 90% of the patent application has less than 100 cited references.
  7. The number of cited patent reference and the number of cited ref- Non patent is almost same in most of the application which is less than 40.
  8. The average number of claims made in the B1 application is higher than the B2 application.
  9. With regards to the inventor count B2 application has more number of inventors.
  10. The count of Cited ref-Patent and Cited ref-Non patent is higher in B2 application which also means in general the number of references cited in B2 type application is higher that B2 application
  11. Patents that come under application type B2 has been cited in other patent applications that B1.
In [ ]: